Subscribe to RSS

We studied a family with hereditary sensory motor neuropathy and deafness accompanying a missense mutation in the MPZ gene.
We have had the opportunity to study a family with deafness and an inherited peripheral neuropathy associated with a novel MPZ mutation. Subject 3?2, was a surgical nurse, and was noted on a routine physical examination at age 49 years, to have hypertension and non?reactive pupils (Adie’s). At 74 years of age, the patient had transient ischaemic attacks and underwent right carotid endarterectomy. Neurological examination on June 25, 1997 at age 75 years, revealed bilateral Adie’s pupils, deafness, unsustained nystagmus on lateral gazes, atrophy and weakness of the hands and feet with preserved proximal strength, and absent deep tendon reflexes in the lower limbs. Her two daughters (subjects 4?1, 4?2) developed hearing loss during their fourth decades a few years after the appearance of symptoms of peripheral nerve involvement (numbness and weakness). Blood samples were drawn from three affected family members (3?2, 4?1, 4?2) and from subject 5?3, who was unaffected. Allele specific PCR was performed using the forward primer, Poex3?P4, with two different reverse primers each designed to amplify either the normal or the mutant allele. Family members (3?2, 4?1, 4?2, 5?3) were tested for pure tone thresholds, speech discrimination, acoustic middle ear muscle reflexes, and OAEs.
Eye movements were measured in subjects 3?2 and 4?1 during caloric stimulation of the vestibular system (for details see Fujikawa and Starr, 2000). Nerve conduction velocities were tested for subjects 3?2, 4?1 and 4?2 using surface recording and stimulating procedures. Sural nerve biopsies were performed on subject 3?2 at age 70 and 77 years, the latter as part of the post mortem studies. The brain, spinal cord, sural nerves and temporal bones were removed from subject 3?2 at time of death. The temporal bones were placed in 10% buffered formalin and shipped to the temporal bone laboratory of the House Ear Institute (Los Angeles, CA, USA). Auditory temporal and frequency discrimination abilities were assessed in subjects 4?1 and 4?2, and a group of normal?hearing listeners.
Subject 4?1 and an age? and gender?matched control with normal hearing were studied using long?latency, auditory cortical potentials evoked in response to a tone burst at several intensity levels.
Continuous records were processed off?line to adjust for DC drift and to correct for ocular artefacts. The latency variability of the N100 component of the single trials comprising the averaged response was determined using a template matching procedure.
Figure 1 contains the pedigree (top panel) and the results of allele?specific PCR (bottom panel) for subjects 3?2, 4?1, 4?2 and 5?3. Sequencing revealed the presence of a missense mutation in exon 3 of the MPZ gene in each of the affected members.
We will be provided with an authorization token (please note: passwords are not shared with us) and will sync your accounts for you.
A modified auditory n-back task was used to examine the ability of young and older listeners to remember the content of spoken messages presented from different locations. Many people have difficulty participating in conversations when listening conditions are not ideal.
Many studies have shown that cognitive abilities generally diminish with age (see Salthouse, 2010, 2012, for reviews), but the degree to which this reduces the ability to follow a multitalker conversation is not clear. The implications of age-related changes in cognitive abilities for speech understanding are not always clear. Given the large individual differences in speech-understanding abilities and the dependency of age effects on the specifics of the speech task, it is difficult to predict how age-related changes in hearing and cognition will affect performance in more complex everyday listening situations.
The present study uses an approximation of a multitalker sequential conversation to examine the influence of several factors on the ability to understand and recall information in a series of spoken sentences. In the present study, a modified n-back task is used to measure the ability to recall information in sentences spoken by different talkers at different times in a series of spoken messages. The standard version of the n-back task has two characteristics that make it unsuitable for assessing sequential multitalker-conversation abilities. Verhaeghen and Basak (Verhaeghen and Basak, 2005; Basak and Verhaeghen, 2011) have used a visual n-back task that shares some properties with the present task. Although subjects are asked to remember (and compare) only one key word in each sentence, the additional information in the full sentence adds to the processing burden and is potentially distracting. In addition to the changes in modality and stimulus complexity, the current studies also differ from earlier n-back studies by including a manipulation of the variability in the sentences across trials as a way to measure effects of complexity and stimulus uncertainty on performance. Although the modified n-back task used in this study does not have all of the characteristics of a real sequential multitalker conversation, the task and the various conditions used allow for tests of the role of many factors that may play an important role in the ability to follow a real-world multitalker conversation.
The first experiment examined performance on a modified auditory n-back task by younger and older adults with normal hearing. The stimuli were sentences from the Coordinate Response Measure (CRM) Corpus (Bolia et al., 2000).
All testing was done in a sound-treated booth that met or exceeded ANSI guidelines for permissible ambient noise for earphone testing (American National Standards Institute, 1999). On each trial, a single CRM sentence was presented to the left, right, or both earphones to simulate left, right, or center locations, respectively, for the apparent source. A trial block consisted of a sequence of 33 trials with location repetitions beginning on the fourth trial. In three different uncertainty conditions, the selection of non-target words in the sentences and the assignment of talkers (voices) to different locations were varied. All subjects were presented with all six conditions, with a different counterbalanced order of conditions for each subject. Pathological examination of the cochlea in one of the family members revealed marked loss of auditory ganglion cells and central and peripheral auditory nerve fibres within the cochlea. Those studies showed selective loss of auditory nerve and ganglion cells in the presence of preserved inner and outer hair cells.
Affected family members had a mild?to?moderate pure tone loss with audiological and neurophysiological findings typical of AN. 1) originated from Costa Rica and medical information for the first and second generations was derived from family histories. 1 (Top) The pedigree structure for the family in this study with HSMN and deafness accompanied by an MPZ mutation. Two months later, she had symptoms consistent with a small brainstem infarction and also developed right temporal lobe haemorrhage and a right subdural haematoma.
Sensory functions (touch, vibration and proprioception) in the toes were markedly impaired, but only slightly affected in the fingers. Neurological examination in the siblings revealed Adie’s pupils, absent ankle jerks, elevated threshold to vibration in the feet, slight weakness of distal muscles and no enlargement of peripheral nerves. DNA was extracted from these samples, and each of the six exons of MPZ was amplified and sequenced in the samples from the affected individuals using the primers and conditions given in Nelis et al. The reverse primer sequences used were Poex3?M21N (5??CTCACACCTTTTTCAAAGACAT?3?) to amplify the normal allele and Poex3?M21A (5??CTCACACCTTTTTCAAA GACAG?3?) to amplify the mutant allele.
Auditory brainstem potentials were tested in subjects 4?1 and 4?2 (for details of the test procedures see Starr et al., 1996).
The vestibular and cochlear nerves were sampled within 0.5 cm of the brainstem, immersed in 2% gluteraldehyde, and subsequently embedded in epon. Upon arrival the left bone was perfused with 2% osmium tetraoxide to protect the myelin from the various solvents used in the routine staining processes. Temporal discrimination measures included gap detection and detection of amplitude modulations for noise bursts of 500 ms duration presented at a comfortable loudness level; frequency discrimination was measured at 250, 500, 1000, 2000, 4000 and 8000 Hz and was presented at the maximal comfortable loudness level.
Brain potentials were recorded from midline frontal (Fz), central (Cz) and parietal (Pz) scalp sites referenced to linked mastoids. Single trial epochs were derived from the continuous records for a period of 100 ms before to 500 ms after the stimulus. The method involved calculating the correlation (Pearson product?moment) between the points in the template, the averaged N100 for that subject, with corresponding points in a segment of the raw EEG (for details see Michalewski et al., 1986).
Both the normal and the mutant alleles are detected in the affected individuals (3?2, 4?1, 4?2), while only the normal allele is present in 5?3, demonstrating that the mutant allele segregates with the disease phenotype. 2 (A) Forward and (B) reverse DNA sequences for a portion of exon 3 of MPZ in one of the affected individuals (4?1), and (C) the reverse sequence for the unaffected subject (5?3). This means that you will not need to remember your user name and password in the future and you will be able to login with the account you choose to sync, with the click of a button. This page doesn't support Internet Explorer 6, 7 and 8.Please upgrade your browser or activate Google Chrome Frame to improve your experience.
The messages were sentences from the Coordinative Response Measure (CRM) corpus, and the task was to judge whether a target word on the current trial was the same as in the most recent presentation from the same location (left, center, or right). Speaking with one person face-to-face in a quiet environment is considerably easier than conversing with a group in a noisy restaurant, and the difficulty tends to be greater for older listeners, especially those with hearing loss (Humes, 2002; Humes and Dubno, 2010). The task of following a conversation consisting of interleaved messages from multiple talkers may involve several distinct abilities.
When present, hearing loss is often the primary reason for a decrease in speech-understanding ability with increasing age, but cognitive factors also play an important role.
Much of what is known about the influence of hearing loss and cognitive abilities on speech understanding comes from studies that require subjects to recall words immediately after presentation of a single word or sentence. To assess the role of aging and hearing loss on this task, the study employs young, normal-hearing (YNH) adults, and older adults, with and without hearing loss. The task requires subjects to judge whether information presented on the current trial matches that presented on an earlier trial, one or more (n) trials back in a sequence of trials.
The use of this type of task makes it possible to assess components of working memory (such as focus switching and memory for items outside the focus of attention) and determine their influence on the ability to follow a multitalker conversation.
First, in conversation we need to keep track of who said what, but a precise ordering of the different participants' contributions to the conversation is generally not important, as long as we follow the flow of the conversation.
As illustrated, the subject must retain both what was said (a spoken digit in this example) and from where it originated (left, center, or right).


An example of 10 trials of an auditory n-back task with spoken digits presented from three locations; left, center, or right. For a set size of one, when focus switching is never required, older adults were as accurate as younger adults and performed nearly perfectly.
Similar to the illustration in Table 1, full sentences are presented auditorily from different apparent locations (left, center, or right) over headphones. This includes a condition in which the same sentence spoken by the same talker is used across trials with only a change in the key word (minimum uncertainty), plus a condition with variation in talkers and sentences across trials (maximum uncertainty).
These include focus switching, memory search, the availability of items in memory (outer store), cognitive load, distraction, uncertainty, the use of location cues, and the use of indexical properties of speech. Based on performance with a similar visual task (see Oberauer, 2006; Basak and Verhaeghen, 2011), it was expected that older subjects would be slower and less accurate than younger subjects, but that the two groups would have similar switching costs, as evidenced by the relative increase in RT from n = 1 (when no focus switching is required) to n = 2 (when focus switching is required). This corpus consists of a collection of sentences spoken by four male and four female talkers. This relatively high presentation level was used to approximate the levels used with the older hearing-impaired (OHI) listeners in Experiment 2.
An example of the first 10 trials of a block is shown in Table 2, with number as the target word. An example of 10 trials of the modified auditory n-back task, with number as the target word. The authors noted their subjects had difficulties with speech comprehension out of proportion to the pure tone loss, a finding characteristic of most patients with AN (Starr et al., 1996). Subject consents for the research were obtained according to the Declaration of Helsinki and followed the guidelines of the Institutional Review Board of the University of California, Irvine, for research involving human subjects. At age 53 years, she discontinued working in the operating room because of increasing numbness of hands and clumsiness affecting her ability to handle surgical instruments. An autopsy was performed and the brain, proximal portions of the sural nerves, and both temporal bones were removed and processed for histological studies. The stapes was removed using a tympanotomy approach and the osmium was introduced through the round window membrane by means of a No.
Eye movements were monitored from electrodes located above and below the right eye; a ground electrode was on the forehead. Accepted single trials were then averaged and the latency and amplitude of the N100 cortical component in the average were computed. A computer program positioned the template 50 ms before N100 and moved 100 ms while computing the correlations at each data point. The extent of low frequency loss (<2000 Hz) differed by ?30 dB across the three subjects. The number of trials between comparison items (the number back) was varied while keeping the number of items to be held in memory (the number of locations) constant.
Many factors can make listening conditions more difficult, including background noise, competing speech sounds, reverberation, poor enunciation, and other types of distraction or signal degradation (see Mattys et al., 2012, for a recent review).
Although a multitalker conversation puts demands on working memory, in that listeners are required to keep information in memory while processing new information from each new talker, it also involves other abilities that may be independent of the simultaneous memory and processing abilities assessed by working memory tasks. However, in everyday listening situations, successful communication requires more than recognition and immediate recall. To perform this task, a subject must hold the last n items in memory, so that the identity of the item n presentations prior to the current one is always available as new items are presented. That is, we can generally follow a conversation quite well even if we are not sure whether two or three other people have spoken since the person sitting next to us last spoke.
Subjects are asked to judge whether a target word in the sentence they just heard is the same as that in the most recent sentence presented from the same location. A third condition more closely approximates a real sequential multitalker situation by having a constant talker-location correspondence while maintaining the same stimulus variability as the maximum uncertainty condition. To determine how these factors are affected by hearing loss and aging, two experiments were conducted: one with young and older adults with normal hearing, and one with older hearing-impaired adults tested with and without spectral shaping (amplification) to ensure full audibility of the stimuli.
The increased processing load due to the use of full sentences, rather than single letters or numerals, was expected to have a greater impact on the older listeners. For those listeners, the stimuli were amplified to ensure audibility (at least 13 dB above threshold) for frequencies from 125 to 4000 Hz, often resulting in presentation levels above 80 dB SPL. Stimuli were presented by computer using a Digital Audio Labs Card Deluxe sound card and a Tucker Davis Technologies System-3 HB7 headphone buffer. In the high uncertainty condition, the talker and the two variable nontarget words (color and either call sign or number) were selected randomly on each trial.
The outer hair cells were normal in number except for a 30% reduction in just the apical turn.
This disorder is associated with mutations in a gene called NDRG1, which encodes a ubiquitously expressed protein that is present at high levels in Schwann cells (Kalaydjieva et al., 2000). Recently, Nadol (2001) reviewed temporal bone findings from adults with ‘sensorineural deafness’ and peripheral neuropathy and showed depletion of ganglion cells with relatively normal hair cell populations. We also made quantitative physiological and psychophysical studies of affected family members to provide objective measures of temporal synchrony and intensity processes in AN.
Three of the four members of the first generation (1?1, 1?2, 1?3) were affected by ‘heavy legs’.
At age 59 years, she experienced hearing problems affecting her ability to understand speech. Additionally, exon 3 was PCR amplified and sequenced in the unaffected family member and 50 unaffected control samples.
Teased fibre studies and nerve fibre counts were performed in subject 4?2 by Dr Andrew Verity at the University of California, Los Angeles. Vestibular and cochlear nerves were also taken from a decreased elderly subject without a history of hearing impairment to serve as a control. The detection of signals in noise was also measured in subject 4?1 and an age?matched control with normal hearing.
N100 was identified in the EEG as the largest positive correlation between the template and corresponding single trial data points. In A and B two bands are present at this position, showing that 4?1 is heterozygous (AC in the forward and TG in the reverse sequence). In contrast, high tone frequency thresholds (>4000 Hz) differed by ?90 dB, being profound in subject 3?2 at age 68 years, moderate in subject 4?1 at age 57 years and mild in subject 4?2 at age 46 years.
One very common factor, often confounded with background noise, is the presence of multiple talkers participating in a group conversation.
For example, localization ability, selective listening abilities, the ability to make use of partial information, and the ability to deal with uncertainty may all come into play in a multitalker listening situation. There are very large individual differences in speech-understanding abilities at all ages, so one must be careful about generalizations concerning the abilities of younger vs.
This paradigm, described in more detail below, provides a means of assessing memory for words in different sentence positions under different levels and types of uncertainty, or variability, across trials. For this basic version of the task, n is therefore equal to both the number of presentations back in the sequence for the comparison item and the memory set size. Their work has examined effects of aging on the ability to switch items stored in memory in and out of the focus of attention (focus switching) and the probability of recalling items stored outside of the focus of attention (item availability). Second, people do not contribute to a conversation in a fixed order, with everyone contributing once before contributing again.
As noted, the accuracy of the responses is recorded together with the RTs and both are examined as a function of n.
This creates a more natural task that resembles the task of listening to three people (separated in space) and keeping track of who said what. This medium-uncertainty condition provides a test of the potential benefit due to the ecological validity of each location being associated with a different specific voice (or person) as well as the potential benefit due to comparisons of words spoken in the same voice. This would lead to larger age differences in percent-correct performance than seen in related earlier studies with simpler stimuli, and possibly to reduced efficiency in memory search, which would tend to increase RTs on trials with n > 1, due to slower searching for items in the outer store. All YNH listeners had pure tone thresholds ≤ 25dB HL (ANSI, 2004) for all octave frequencies between 250 and 8000 Hz. Three talkers (two male and one female), judged to be maximally distinguishable by three research assistants, were selected for this study. Each listener was seated in front of a touchscreen monitor, with a keyboard and mouse available. A third, more ecologically valid, condition had the same random variation in nontarget words, but had a consistent mapping of talker and location. Examination of the sural nerve and the auditory nerve adjacent to the brainstem showed marked loss of fibres with evidence of incomplete remyelination of some of the remaining fibres.
A neuropathy of the auditory nerve with demyelination and axonal loss would affect both the synchrony of firing and the capacity of the nerve fibres to discharge at high rates (Starr et al., 2001a).
The hearing disorder in these patients was not tested in sufficient detail to confirm a diagnosis of AN. Subjects 4?1* (lanes 2 and 3), 4?2* (lanes 4 and 5) and 3?2* (lanes 8 and 9) have both the normal and the mutant allele, while for 5?3* (lanes 6 and 7) the normal allele is present, but the mutant allele is absent. At age 64 years, she developed urinary and fecal incontinence and enlargement of the tongue. In brief, for exon 3 the intronic primers, Poex3?P4 (5??TCATTAGGGTCCT CTCACATGC?3?) and Poex3?M21 (5??GCCTGAATAAA GGTCCTTAGGC?3?), were used for amplification resulting in a 368 base pair product.
The signal was a 200 ms duration 1000 Hz tone and the noise was a white noise that had a 20–14 000 Hz bandwidth and a 500 ms duration. Both of these figures show clearly the presence of two bands at position 434 (marked by an arrow), indicating that 4?1 is heterozygous at this position. Speech discrimination was impaired in all even when the audiogram was only mildly affected [Table 1, subjects 3?2 and 4?1, compare pure tone audiogram and speech discrimination].
Low- and high-uncertainty conditions were created by holding the talker (voice) and nontarget words constant, or varying them unpredictably across trials. Such conversations often take place in noisy environments with the participants talking over each other; but even in a quiet environment with polite turn taking, this can be a challenging listening situation for some listeners.


These abilities may be largely independent and may not be affected by aging in the same way. The n-back task provides a convenient framework for examining these variables in an experimental paradigm that has many features in common with a sequential or turn-taking multitalker conversation. The task is typically performed in the visual modality with single letters or digits presented individually in a sequence. Both of these constraints can be eliminated with an auditory n-back task simply by presenting stimuli from fixed locations and asking subjects to judge whether the stimulus they just heard in a given location is the same as the last one they heard in that same location. This shows that, at least under some conditions, older adults have more difficulty maintaining information both inside and outside the focus of attention than do younger adults. The use of target words early and late in the sentence provides a test of potential memory interference due to irrelevant information preceding or following the target word.
The contents of each of the 33 trials in a block were randomized with the following constraints. This medium uncertainty condition creates the impression of a different specific person at each location, while maintaining the same amount of stimulus variability as in the high uncertainty condition.
Studies of auditory function in surviving family members using electrophysiological and psychoacoustic methods provided evidence that the hearing deficits in this form of auditory neuropathy were probably related to a decrease of auditory nerve input accompanying axonal disease. However, extensive audiological characterization of the deafness in patients with MPZ mutations has not been reported.
Subject 1?3 had only one child (2?1) who immigrated to the US and developed ‘heavy legs, foot drop, small hands’ at 35 years of age. She underwent retropubic urethropexy and posterior colporrhaphy for stress incontinence and rectocele. Fixation was followed by decalcification in ethylenediaminetetraacetic acid until shown by X?ray, after 9 months, to be calcium free.
The acoustic stimuli were presented from an electrically shielded transducer coupled to a 20 cm length of plastic tubing to a foam insert placed within the ear canal.
N100 latency for each trial was estimated by computing how far (number of dwell points) the template was moved relative to the starting point.
This A to C mutation at position 434 results in an amino acid change from tyrosine to serine at codon 145 (Tyr145>Ser), which is located in the hydrophobic extracellular domain of MPZ. In a medium-uncertainty condition, each location was associated with a specific talker, thus increasing predictability and ecological validity.
Following a sequential or turn-taking multitalker conversation generally requires a listener to keep track of interleaved remarks from multiple talkers. With the n-back task, focus switching and item search time (for items in the outer store) can be assessed by measuring the time required to judge whether the current item was repeated n trials ago as a function of n (which is also equal to the number of items that must be held in memory to perform the task).
With this task, the number of items to be remembered (or set size) is equal to the number of locations used. However, no differences were found between young and older subjects in focus-switching costs, measured by response times, when general slowing was taken into account.
Finally, the use of the different uncertainty conditions provides a test of the effect of stimulus variability on younger and older listeners as well as a test of the possible benefit due to the consistent mapping of voices to locations, which more closely approximates an everyday listening situation. All subjects had normal tympanograms and otoscopic findings and showed no evidence of middle ear pathology. The factorial combination of these three conditions with the two Target conditions (call sign and number) resulted in six conditions.
Altered synchrony of discharge of the remaining fibres was a possible additional contributing factor. This disturbance of temporal encoding would also affect the precise timing of neural discharges and the ability to obtain an ABR (Starr et al., 1991). The PCR products were loaded on a 1% agarose gel to verify size and quantity, then the DNA fragments were extracted from the gel and purified using the Qiaex II Gel Extraction Kit (Qiagen). Figure 2C shows that the unaffected family member (subject 5?3) has only one band at position 434, demonstrating that this individual is homozygous and does not have the A to C mutation.
Older listeners performed slightly worse than younger listeners, but there was no significant difference in response times (RT) for the two groups.
Listening to each new contribution to a conversation while remembering earlier remarks from other talkers and correctly attributing those remarks to the different participants places demands on cognitive abilities that tend to decline with age. Assuming a 1-item capacity for focus of attention, response times (RT) for n = 1 trials can be compared to that for n = 2 trials to obtain a measure of switching time. That is, the relative increase in RTs between one-back trials and two-back (or greater) trials was approximately the same for younger and older subjects.
The YNH subjects were students at Indiana University in Bloomington and the ONH subjects were from the Bloomington, Indiana community.
Subjects were told to respond as quickly as possible without making errors and were encouraged to guess when they felt unsure of the correct response. The number of trials since the last presentation in a given location (n) ranged from 1 to 5, with 6 repetitions of each value of n in each block of trials.
There were eight trial blocks in each condition, for a total of 30 × 8 = 240 observations per condition. A loss of auditory nerve fibres and the inability of remaining fibres to achieve high discharge rates could account for both the absence of middle ear muscle reflexes to high intensity sounds and the failure of sound amplification to benefit hearing (Starr et al., 1996).
She became progressively weak and unsteady in her legs requiring a wheel chair for mobility when she was in her 70s. Manual sequencing in both the forward and reverse directions was carried out using the ThermoSequenase Radiolabeled Terminator Cycle Sequencing Kit according to the manufacturer’s protocol (USB). The resulting celloidin blocks containing the decalcified bones were cut in the horizontal plane into 20 µm sections using a sliding microtome. The subject was seated in a double?walled, sound attenuating booth and listened to the monaurally presented stimuli through a Sennheiser HAD?200 headphone. In addition, the PCR product for 4?1 was cloned and four independent clones were sequenced. An effect of the number back (n) was seen for both PC and RT; PC decreased steadily with n, while RT was fairly constant after a significant increase from n = 1 to n = 2.
Moreover, n-back tasks have been shown to have a fairly weak correlation with other measures of working memory that consist of interleaved memory and processing tasks (Redick and Lindsey, 2013). This is because on one-back trials, the current item is compared to the immediately preceding item, an item that is still held in the focus of attention, while on two-back trials, an item must be switched from the outer store into the focus of attention.
The ONH subjects (with 2 exceptions) had served in an earlier individual differences study (Humes et al., 2013), which had included screening for serious cognitive and physical impairment. Each of the 8 target words (call signs or numbers) was used at least twice and no more than 8 times within a trial block. Subjects were not told about the differences across conditions in the number of talkers, sentence variability, or the assignment of talkers to locations. Subject 2?1 had only one child, 3?2, who developed motor loss and deafness at age 50 years. Every tenth section was stained with haematoxylin and eosin, mounted on a slide, and topped with a coverslip. Three of these clones had the A nucleotide at position 434 and one of them had the C nucleotide, again demonstrating that 4?1 is a heterozygote. Apart from the lower PC for the older group, there was no effect involving age for either PC or RT.
Any increase in RT with further increases in n indicates search time for items in the outer store.
The highest level of education completed ranged from high school (one subject) to vocational school (two subjects), college (five subjects), and graduate school (four subjects). All subjects began with four practice trial blocks: two with the number target, followed by two with the call sign target.
Also, this mutation was not present in 100 control chromosomes (50 unrelated, unaffected individuals).
There was an effect of target word location (faster RTs with a late-occurring target) and an effect of uncertainty (faster RTs with a constant talker-location mapping, relative to the high-uncertainty condition). The substantial differences in performance on various working memory tasks show that working memory is a complex construct that cannot be effectively assessed with a single measure. In addition to memory search efficiency, the availability of items in the outer store can be assessed by examining percent-correct performance as a function of n.
Hair cells were counted in the midmodiolar and two paramidmodiolar mounted sections and in the hook area for a total of 21 segments of the organ of Corti.
Although the possibility that this is a rare variant is not excluded, our findings are consistent with the mutation being the cause of the phenotype. A similar pattern of performance was observed with a group of elderly hearing-impaired listeners (with and without shaping to ensure audibility), but RTs were substantially slower and the effect of uncertainty was absent. However, the n-back task has some properties that make it useful for the assessment of certain features of working memory in the context of a sequential multitalker conversation.
Subject recruitment and all experimental procedures were reviewed and approved by the IRB at Indiana University. Subject 4?3 has not been examined but family members report the presence of a hearing loss.
Apart from the observed overall slowing of RTs, these results provide little evidence for an effect of age-related changes in cognitive abilities on this task. We have also examined one subject in the fifth generation, 5?3, whose neurological and audiological functions were normal at age 32 years. The auditory nerve fibres were not counted as there was obvious severe degeneration that mirrored the loss of ganglion cells in the modiolus.



Continuous noise in my ear
Tune out tinnitus org uk




Comments to «High frequency hearing loss in young adults yorkshire»

  1. T_A_N_H_A writes:
    Skin lining the ear canal.
  2. ANTIKVAR writes:
    Toes healed espressos and lattes consumed on cafe terraces across Europe.
  3. samira writes:
    Advantage of the plasticity of the brain, tinnitus habituation retrains tinnitus can can't test.