SNPMiner Trials by Shray Alag

NCT00511368 (37) NCT00460382 (36) NCT04504071 (35) NCT03783286 (33) NCT04172597 (32) NCT02404233 (29) NCT00959894 (28) NCT00706147 (28) NCT00121017 (28) NCT01685801 (27) NCT04513626 (26) NCT01736761 (26) NCT04495348 (24) NCT02673398 (23) NCT02499978 (22) NCT01605084 (21) NCT04254705 (21) NCT02069834 (21) NCT00939770 (18) NCT01792570 (18) NCT01199939 (18) NCT00356616 (18) NCT02728258 (17) NCT02707601 (17) NCT02770508 (16) NCT00711009 (16) NCT00630864 (16) NCT00491556 (15) NCT04085315 (15) NCT02616029 (15) NCT00830804 (15) NCT04681820 (15) NCT01170962 (14) NCT00984152 (14) NCT03953898 (14) NCT00727597 (14) NCT03212274 (14) NCT01369199 (13) NCT00337467 (13) NCT00098293 (13) NCT01368497 (13) NCT02159599 (13) NCT00424814 (12) NCT04432454 (12) NCT02527096 (12) NCT01849003 (12) NCT03781063 (12) NCT03683524 (11) NCT01614457 (11) NCT00460746 (11) NCT00993148 (11) NCT03061331 (11) NCT02494882 (11) NCT03068312 (11) NCT04453436 (11) NCT01521338 (10) NCT02725567 (10) NCT01614470 (10) NCT01423812 (10) NCT00358917 (10) NCT04415268 (10) NCT00511381 (10) NCT03911713 (9) NCT02742519 (9) NCT03045523 (9) NCT00438152 (9) NCT01102972 (9) NCT02971839 (9) NCT00740064 (9) NCT02605954 (9) NCT00379405 (9) NCT01562847 (9) NCT02616783 (9) NCT04272242 (9) NCT02445053 (9) NCT00242840 (9) NCT02724527 (9) NCT04209465 (9) NCT04585737 (8) NCT02082977 (8) NCT00112775 (8) NCT00383318 (8) NCT03659214 (8) NCT03631732 (8) NCT00118898 (8) NCT01888562 (8) NCT02633189 (8) NCT03565692 (8) NCT03843775 (8) NCT01161576 (8) NCT02167165 (8) NCT00344461 (8) NCT04519398 (7) NCT02154490 (7) NCT03232892 (7) NCT00650832 (7) NCT04549025 (7) NCT00440947 (7) NCT02784639 (7) NCT03572140 (6) NCT01237444 (6) NCT00532168 (6) NCT01102569 (6) NCT04424368 (6) NCT01414985 (6) NCT00525733 (6) NCT02308332 (6) NCT01487265 (6) NCT00049933 (5) NCT02389920 (5) NCT03351699 (5) NCT04197934 (5) NCT02272998 (5) NCT00122590 (5) NCT04204330 (5) NCT02450591 (5) NCT01173029 (5) NCT02675829 (5) NCT02858921 (5) NCT01914484 (5) NCT00187733 (5) NCT02554591 (5) NCT01501604 (5) NCT02716116 (5) NCT01136460 (5) NCT00187655 (5) NCT00350272 (5) NCT00837135 (5) NCT03202862 (5) NCT01707199 (5) NCT03839342 (5) NCT01323010 (4) NCT02248324 (4) NCT01698905 (4) NCT01737359 (4) NCT01306045 (4) NCT02804100 (4) NCT01456676 (4) NCT00588172 (4) NCT03434418 (4) NCT03593993 (4) NCT01804140 (4) NCT02882308 (4) NCT03497767 (4) NCT04106024 (4) NCT02716311 (4) NCT04405674 (4) NCT03599518 (4) NCT01675778 (4) NCT01604122 (4) NCT01297777 (4) NCT04519970 (4) NCT00705679 (4) NCT04147351 (4) NCT04129502 (4) NCT03976856 (4) NCT02335944 (4) NCT04625647 (4) NCT03948763 (4) NCT03255083 (4) NCT04002830 (4) NCT02635815 (4) NCT03066206 (4) NCT01331642 (4) NCT00557245 (4) NCT01922583 (4) NCT02893332 (4) NCT03592888 (4) NCT02257424 (4) NCT03874858 (4) NCT00017732 (4) NCT00187720 (4) NCT02593539 (4) NCT01185587 (4) NCT04439292 (4) NCT03884348 (4) NCT01309243 (4) NCT03209063 (4) NCT04160546 (4) NCT03292302 (4) NCT02418234 (4) NCT02535338 (3) NCT02192697 (3) NCT03410043 (3) NCT03845296 (3) NCT02914990 (3) NCT02113813 (3) NCT01532011 (3) NCT04340388 (3) NCT00962533 (3) NCT03856411 (3) NCT04049266 (3) NCT02973763 (3) NCT02926092 (3) NCT00271973 (3) NCT04256941 (3) NCT03812809 (3) NCT02954523 (3) NCT01784068 (3) NCT03446417 (3) NCT02841579 (3) NCT02025114 (3) NCT01288521 (3) NCT01385683 (3) NCT02279004 (3) NCT00998582 (3) NCT03111901 (3) NCT01352715 (3) NCT01619774 (3) NCT01045369 (3) NCT02246998 (3) NCT03969823 (3) NCT00895596 (3) NCT02398929 (3) NCT00724711 (3) NCT04029350 (3) NCT03737994 (3) NCT01443806 (3) NCT02629822 (3) NCT03463525 (3) NCT00710112 (3) NCT03623750 (3) NCT04283955 (3) NCT02743923 (3) NCT01016106 (3) NCT01259089 (3) NCT03971474 (3) NCT02917993 (3) NCT02368990 (3) NCT00279110 (3) NCT02485652 (3) NCT00312169 (3) NCT04541407 (3) NCT02769286 (3) NCT00747487 (3) NCT04267913 (3) NCT01429597 (3) NCT04023617 (3) NCT03790228 (3) NCT01759888 (3) NCT04429152 (3) NCT01810718 (3) NCT02725632 (3) NCT01090011 (3) NCT04544111 (3) NCT02926768 (3) NCT02981108 (3) NCT02459743 (3) NCT00654823 (3) NCT01037127 (3) NCT04439305 (3) NCT01028222 (3) NCT01542411 (3) NCT01031446 (3) NCT02726269 (3) NCT01892644 (3) NCT03260491 (3) NCT01802632 (3) NCT02720094 (3) NCT02630186 (3) NCT01627132 (3) NCT02690675 (3) NCT01013506 (3) NCT04252339 (3) NCT02496663 (3) NCT03386955 (3) NCT03394118 (3) NCT04212702 (3) NCT01754025 (3) NCT01160276 (3) NCT00121979 (3) NCT03228277 (3) NCT04351555 (3) NCT01243346 (3) NCT04510415 (3) NCT02796274 (3) NCT02774005 (3) NCT02064491 (3) NCT04233021 (3) NCT03799601 (3) NCT00260260 (3) NCT02094261 (3) NCT04245085 (3) NCT03058094 (3) NCT01282151 (3) NCT02520778 (3) NCT03161808 (3) NCT04181060 (3) NCT01342679 (3) NCT01443273 (3) NCT01593254 (3) NCT04433481 (3) NCT02529995 (3) NCT03502850 (3) NCT02771314 (3) NCT03823807 (3) NCT03270527 (3) NCT02688881 (3) NCT01005602 (3) NCT02442349 (3) NCT02684591 (2) NCT02282267 (2) NCT03381430 (2) NCT02178397 (2) NCT03608215 (2) NCT02603107 (2) NCT03370770 (2) NCT03322696 (2) NCT03333343 (2) NCT00525473 (2) NCT03127449 (2) NCT01781026 (2) NCT02503722 (2) NCT00975871 (2) NCT03964233 (2) NCT03388099 (2) NCT02317016 (2) NCT03845270 (2) NCT03519958 (2) NCT03918304 (2) NCT02151721 (2) NCT02777658 (2) NCT01016444 (2) NCT02971501 (2) NCT03101254 (2) NCT03178617 (2) NCT01774721 (2) NCT03574753 (2) NCT01357655 (2) NCT01766713 (2) NCT02097225 (2) NCT00658164 (2) NCT03622593 (2) NCT02571036 (2) NCT00969137 (2) NCT00834665 (2) NCT02026011 (2) NCT03622580 (2) NCT03543683 (2) NCT01143493 (2) NCT03671538 (2) NCT04028778 (2) NCT00324961 (2) NCT01915576 (2) NCT02157883 (2) NCT01387022 (2) NCT03864042 (2) NCT03235245 (2) NCT03469960 (2) NCT02795884 (2) NCT04687241 (2) NCT00005541 (2) NCT01242813 (2) NCT03960645 (2) NCT00643058 (2) NCT03443336 (2) NCT02992860 (2) NCT02281760 (2) NCT02201602 (2) NCT04310007 (2) NCT04309019 (2) NCT03720665 (2) NCT00909532 (2) NCT00411944 (2) NCT01604681 (2) NCT01245062 (2) NCT00270231 (2) NCT03256136 (2) NCT03973918 (2) NCT00302692 (2) NCT00125281 (2) NCT02163733 (2) NCT02110407 (2) NCT00475176 (2) NCT03196882 (2) NCT01572818 (2) NCT02556333 (2) NCT04268550 (2) NCT02433717 (2) NCT03428126 (2) NCT01153763 (2) NCT02609776 (2) NCT01420211 (2) NCT03556176 (2) NCT03872440 (2) NCT01405079 (2) NCT03382795 (2) NCT02991950 (2) NCT00013598 (2) NCT03455764 (2) NCT02422628 (2) NCT03831932 (2) NCT03766490 (2) NCT02580474 (2) NCT00499577 (2) NCT02444884 (2) NCT01775943 (2) NCT03544814 (2) NCT01310036 (2) NCT01027663 (2) NCT01928160 (2) NCT01244438 (2) NCT00007150 (2) NCT04462081 (2) NCT02297425 (2) NCT02086071 (2) NCT01050400 (2) NCT03060590 (2) NCT01819428 (2) NCT02709668 (2) NCT02411448 (2) NCT03878719 (2) NCT04622072 (2) NCT04479306 (2) NCT03377023 (2) NCT01378026 (2) NCT03239145 (2) NCT04511533 (2) NCT00226551 (2) NCT02191891 (2) NCT04586270 (2) NCT04669535 (2) NCT04545710 (2) NCT02120222 (2) NCT02738593 (2) NCT00831272 (2) NCT04469543 (2) NCT00573495 (2) NCT04158544 (2) NCT00904150 (2) NCT02110056 (2) NCT02856893 (2) NCT02110043 (2) NCT02182986 (2) NCT04179890 (2) NCT00063232 (2) NCT02197234 (2) NCT03121235 (2) NCT01532089 (2) NCT03887169 (2) NCT02268864 (2) NCT01963845 (2) NCT00866736 (2) NCT03991013 (2) NCT02500927 (2) NCT04657991 (2) NCT02228382 (2) NCT02689570 (2) NCT01513785 (2) NCT02463435 (2) NCT03351361 (2) NCT04527549 (2) NCT03424759 (2) NCT02197247 (2) NCT02321046 (2) NCT04272034 (2) NCT04646824 (2) NCT04027647 (2) NCT02364609 (2) NCT02759835 (2) NCT04349865 (2) NCT00068159 (2) NCT00418015 (2) NCT04310397 (2) NCT03088176 (2) NCT03867175 (2) NCT00339209 (2) NCT00011258 (2) NCT01288430 (2) NCT01616199 (2) NCT03603262 (2) NCT03071705 (2) NCT00969930 (2) NCT00772408 (2) NCT02743468 (2) NCT00277342 (2) NCT04248829 (2) NCT01767454 (2) NCT00933127 (2) NCT03317873 (2) NCT03392246 (2) NCT01909453 (2) NCT03523104 (2) NCT00085917 (2) NCT02507921 (2) NCT03781752 (2) NCT03828422 (2) NCT02193282 (2) NCT03195452 (2) NCT04657289 (2) NCT02294487 (2) NCT01325441 (2) NCT02511106 (2) NCT02997501 (2) NCT04184921 (2) NCT00625092 (2) NCT01657786 (2) NCT01415011 (2) NCT02629523 (2) NCT01718847 (2) NCT02818023 (2) NCT00577707 (2) NCT01943422 (2) NCT00116636 (2) NCT04429542 (2) NCT01841463 (2) NCT03865511 (2) NCT03205267 (2) NCT01218477 (2) NCT02881320 (2) NCT01897480 (2) NCT02810990 (2) NCT04189757 (2) NCT01951001 (2) NCT04254939 (2) NCT03207867 (2) NCT00780949 (2) NCT03355768 (2) NCT00817089 (2) NCT02143466 (2) NCT04499053 (2) NCT01907776 (2) NCT00909727 (2) NCT01562028 (2) NCT03737253 (2) NCT00441974 (2) NCT02155465 (2) NCT04586335 (2) NCT00661999 (2) NCT02705339 (2) NCT04006340 (2) NCT04553887 (2) NCT04645225 (2) NCT03852290 (2) NCT02183922 (2) NCT03970239 (2) NCT00294372 (2) NCT03250676 (2) NCT03792074 (2) NCT00671892 (2) NCT00689182 (2) NCT00106379 (2) NCT01947023 (2) NCT00509652 (2) NCT03683251 (2) NCT02039986 (2) NCT03515837 (2) NCT04081688 (2) NCT03190005 (2) NCT01584648 (2) NCT02292654 (2) NCT03992456 (2) NCT03133546 (2) NCT01485809 (2) NCT01266967 (2) NCT04644315 (2) NCT02909712 (2) NCT00062764 (2) NCT01776684 (2) NCT03042221 (2) NCT01940809 (2) NCT04675008 (2) NCT01161537 (2) NCT01154816 (2) NCT01175759 (2) NCT01199731 (2) NCT02788058 (2) NCT03130452 (2) NCT04687423 (2) NCT01772732 (2) NCT02631447 (2) NCT02525692 (2) NCT02526537 (2) NCT03513666 (2) NCT02027961 (2) NCT03106779 (2) NCT04106544 (2) NCT04258943 (2) NCT00165984 (2) NCT00977470 (2) NCT02092974 (2) NCT03975231 (2) NCT03586453 (2) NCT01998295 (2) NCT02021305 (2) NCT03135197 (2) NCT00432016 (2) NCT04636437 (2) NCT03004625 (2) NCT03851445 (2) NCT04031898 (2) NCT04201418 (2) NCT01911507 (2) NCT03539224 (2) NCT01978236 (2) NCT00866177 (2) NCT00320879 (2) NCT00044304 (2) NCT01999179 (2) NCT00977730 (2) NCT02491775 (2) NCT00212147 (2) NCT02040064 (2) NCT00489385 (2) NCT01713023 (2) NCT04122729 (2) NCT03994393 (2) NCT02438722 (2) NCT02762448 (2) NCT00071903 (2) NCT00626223 (2) NCT01193829 (2) NCT03239340 (2) NCT02991274 (2) NCT02811354 (2) NCT03416530 (2) NCT02522988 (2) NCT00953706 (2) NCT03795688 (2) NCT02346955 (2) NCT02011945 (2) NCT00857675 (2) NCT00028262 (2) NCT02355431 (2) NCT04575415 (2) NCT02495233 (2) NCT03468985 (2) NCT00230087 (2) NCT02017600 (2) NCT04146298 (2) NCT02036359 (2) NCT04494789 (2) NCT00193947 (2) NCT02349633 (2) NCT02425397 (2) NCT04209816 (2) NCT00959504 (2) NCT03768908 (2) NCT04035486 (2) NCT04619004 (2) NCT00088803 (2) NCT00567359 (2) NCT04040829 (2) NCT02196181 (2) NCT04563871 (2) NCT02231775 (2) NCT03532698 (2) NCT03529084 (2) NCT03433469 (2) NCT02929693 (2) NCT04339829 (2) NCT03295396 (2) NCT03594916 (2) NCT03373760 (2) NCT01961830 (2) NCT02374645 (2) NCT03706287 (2) NCT04164901 (2) NCT03122717 (2) NCT04424966 (2) NCT02588261 (2) NCT01513174 (2) NCT03283826 (2) NCT02578004 (2) NCT00457821 (2) NCT02124044 (2) NCT02847377 (2) NCT03159117 (2) NCT03898908 (2) NCT03433833 (2) NCT02518802 (2) NCT01726738 (2) NCT00362687 (2) NCT03919474 (2) NCT02616393 (2) NCT02736513 (2) NCT02759614 (2) NCT02099058 (2) NCT01677741 (2) NCT02194881 (1) NCT03119831 (1) NCT01248936 (1) NCT03929458 (1) NCT03974022 (1) NCT03137264 (1) NCT01746277 (1) NCT01266369 (1) NCT03548064 (1) NCT01188785 (1) NCT01359436 (1) NCT02113878 (1) NCT03882281 (1) NCT03206372 (1) NCT01955681 (1) NCT03632317 (1) NCT01385722 (1) NCT03496766 (1) NCT02698748 (1) NCT03473665 (1) NCT01179828 (1) NCT01312337 (1) NCT03300414 (1) NCT02447939 (1) NCT04222283 (1) NCT02091999 (1) NCT01964131 (1) NCT03620318 (1) NCT01449461 (1) NCT04238624 (1) NCT04675710 (1) NCT01349660 (1) NCT02000726 (1) NCT00984360 (1) NCT01269424 (1) NCT00062907 (1) NCT04086680 (1) NCT00079326 (1) NCT02938520 (1) NCT02824952 (1) NCT01999270 (1) NCT01589302 (1) NCT00686270 (1) NCT00542841 (1) NCT00409175 (1) NCT01748019 (1) NCT03128749 (1) NCT04682431 (1) NCT02413736 (1) NCT01543113 (1) NCT00138684 (1) NCT02400437 (1) NCT04556305 (1) NCT02014909 (1) NCT03263364 (1) NCT04691375 (1) NCT03343197 (1) NCT03050437 (1) NCT01417442 (1) NCT03083769 (1) NCT00662688 (1) NCT02511340 (1) NCT03678506 (1) NCT02146365 (1) NCT04310943 (1) NCT02619955 (1) NCT02934139 (1) NCT00400387 (1) NCT00375219 (1) NCT00149305 (1) NCT03520946 (1) NCT02787447 (1) NCT04501614 (1) NCT03166631 (1) NCT04213313 (1) NCT02078531 (1) NCT02349048 (1) NCT02981784 (1) NCT04636593 (1) NCT01647711 (1) NCT03231722 (1) NCT03576937 (1) NCT04412070 (1) NCT00554866 (1) NCT03151161 (1) NCT01817166 (1) NCT02220855 (1) NCT02512627 (1) NCT04591197 (1) NCT03402048 (1) NCT04500704 (1) NCT02323724 (1) NCT01166126 (1) NCT03029858 (1) NCT04317599 (1) NCT00300573 (1) NCT00809211 (1) NCT01393730 (1) NCT02318368 (1) NCT02228369 (1) NCT04500717 (1) NCT01074398 (1) NCT03134131 (1) NCT02455167 (1) NCT01004497 (1) NCT02073279 (1) NCT02117817 (1) NCT00323687 (1) NCT01605981 (1) NCT01371955 (1) NCT04147767 (1) NCT04144257 (1) NCT03490123 (1) NCT04423185 (1) NCT02625337 (1) NCT03567629 (1) NCT03360929 (1) NCT00109278 (1) NCT04108156 (1) NCT02132598 (1) NCT00542451 (1) NCT01587573 (1) NCT00868465 (1) NCT01494402 (1) NCT00867139 (1) NCT03363139 (1) NCT01936051 (1) NCT02341131 (1) NCT00037076 (1) NCT00582907 (1) NCT02169869 (1) NCT03284684 (1) NCT04204473 (1) NCT04678336 (1) NCT01074359 (1) NCT01400191 (1) NCT04530565 (1) NCT03530319 (1) NCT04146402 (1) NCT02658682 (1) NCT04241835 (1) NCT03133234 (1) NCT02251535 (1) NCT00085111 (1) NCT02305095 (1) NCT01645124 (1) NCT03414450 (1) NCT02716246 (1) NCT02308137 (1) NCT04449874 (1) NCT00045942 (1) NCT04604067 (1) NCT03204500 (1) NCT02951052 (1) NCT03236584 (1) NCT03428178 (1) NCT00634595 (1) NCT04677439 (1) NCT02098954 (1) NCT04619563 (1) NCT02463513 (1) NCT03634059 (1) NCT03363217 (1) NCT04381650 (1) NCT01838941 (1) NCT00887562 (1) NCT03934372 (1) NCT04485507 (1) NCT03674502 (1) NCT02075840 (1) NCT01134120 (1) NCT01550640 (1) NCT00737126 (1) NCT00005543 (1) NCT02508532 (1) NCT02722057 (1) NCT02103257 (1) NCT01146132 (1) NCT03365882 (1) NCT00312039 (1) NCT02293733 (1) NCT02906020 (1) NCT00669669 (1) NCT01262352 (1) NCT03268161 (1) NCT03648268 (1) NCT03970447 (1) NCT03594422 (1) NCT02607124 (1) NCT01147445 (1) NCT01260181 (1) NCT03314272 (1) NCT03639714 (1) NCT00152061 (1) NCT04609319 (1) NCT00260897 (1) NCT04551521 (1) NCT01338025 (1) NCT00830245 (1) NCT03593109 (1) NCT00908687 (1) NCT01928940 (1) NCT03045991 (1) NCT03381066 (1) NCT01882205 (1) NCT00405249 (1) NCT04442815 (1) NCT04116502 (1) NCT04079179 (1) NCT01489592 (1) NCT01436656 (1) NCT02130466 (1) NCT02157922 (1) NCT00570401 (1) NCT04622774 (1) NCT01297452 (1) NCT01086267 (1) NCT02928224 (1) NCT01455389 (1) NCT02476851 (1) NCT02961270 (1) NCT02518737 (1) NCT04585750 (1) NCT02359747 (1) NCT01663857 (1) NCT00579683 (1) NCT03602027 (1) NCT01524757 (1) NCT04371848 (1) NCT04436848 (1) NCT02518750 (1) NCT00092391 (1) NCT02070549 (1) NCT00702403 (1) NCT03946748 (1) NCT03654508 (1) NCT04044430 (1) NCT03293524 (1) NCT04133948 (1) NCT01543035 (1) NCT00769587 (1) NCT04448158 (1) NCT00336076 (1) NCT02405247 (1) NCT01453595 (1) NCT03857243 (1) NCT01784939 (1) NCT02806362 (1) NCT00096746 (1) NCT01441128 (1) NCT02652585 (1) NCT03054038 (1) NCT00086957 (1) NCT03336463 (1) NCT04012866 (1) NCT00001566 (1) NCT01482923 (1) NCT04462471 (1) NCT03580655 (1) NCT04173507 (1) NCT01703962 (1) NCT01528774 (1) NCT04485559 (1) NCT00201214 (1) NCT02997228 (1) NCT00395629 (1) NCT03499743 (1) NCT04560413 (1) NCT02460068 (1) NCT01801904 (1) NCT00708162 (1) NCT04418167 (1) NCT03414814 (1) NCT04560894 (1) NCT02666755 (1) NCT02580435 (1) NCT01353625 (1) NCT00233285 (1) NCT04688983 (1) NCT04684147 (1) NCT01225887 (1) NCT01827436 (1) NCT03780738 (1) NCT03559699 (1) NCT01901432 (1) NCT02968303 (1) NCT01328210 (1) NCT00410202 (1) NCT02435927 (1) NCT02931487 (1) NCT01968551 (1) NCT00831974 (1) NCT04201405 (1) NCT02194049 (1) NCT01976104 (1) NCT02695290 (1) NCT01164891 (1) NCT02500147 (1) NCT03721120 (1) NCT01381289 (1) NCT01408589 (1) NCT04012411 (1) NCT03696355 (1) NCT02595944 (1) NCT03670186 (1) NCT01456650 (1) NCT03893357 (1) NCT02606253 (1) NCT03464201 (1) NCT03486496 (1) NCT03883100 (1) NCT00906087 (1) NCT03267654 (1) NCT04427072 (1) NCT02066038 (1) NCT04077372 (1) NCT02400853 (1) NCT03909334 (1) NCT02070536 (1) NCT03562819 (1) NCT00373425 (1) NCT01107418 (1) NCT03502330 (1) NCT03514784 (1) NCT04192292 (1) NCT01709292 (1) NCT02071862 (1) NCT02511288 (1) NCT01570699 (1) NCT02774278 (1) NCT00653666 (1) NCT00618423 (1) NCT00090493 (1) NCT01304602 (1) NCT04316546 (1) NCT03439865 (1) NCT01815255 (1) NCT02023710 (1) NCT04510220 (1) NCT03020095 (1) NCT02707445 (1) NCT01989585 (1) NCT03769103 (1) NCT01531673 (1) NCT02316496 (1) NCT01784419 (1) NCT02089555 (1) NCT02387216 (1) NCT00900185 (1) NCT02547675 (1) NCT04533321 (1) NCT01631279 (1) NCT03621540 (1) NCT01417520 (1) NCT00401999 (1) NCT02326285 (1) NCT04613596 (1) NCT01589445 (1) NCT03686085 (1) NCT01705626 (1) NCT00462943 (1) NCT02133144 (1) NCT04239833 (1) NCT01982955 (1) NCT04537715 (1) NCT01644591 (1) NCT01920204 (1) NCT03678454 (1) NCT00925002 (1) NCT03620669 (1) NCT00708695 (1) NCT01543698 (1) NCT01579630 (1) NCT02385461 (1) NCT03040986 (1) NCT01555697 (1) NCT00090454 (1) NCT03410160 (1) NCT02134015 (1) NCT00274261 (1) NCT04319614 (1) NCT03244956 (1) NCT02961608 (1) NCT01336634 (1) NCT01588145 (1) NCT04603326 (1) NCT01233752 (1) NCT03577314 (1) NCT02086487 (1) NCT00676117 (1) NCT03299049 (1) NCT04226950 (1) NCT03849768 (1) NCT02202200 (1) NCT02956278 (1) NCT03938012 (1) NCT02080715 (1) NCT02364999 (1) NCT04105153 (1) NCT01131325 (1) NCT01116193 (1) NCT01887587 (1) NCT02299622 (1) NCT03803553 (1) NCT00341120 (1) NCT02327169 (1) NCT01738555 (1) NCT02627664 (1) NCT02959749 (1) NCT02032680 (1) NCT00106977 (1) NCT03727763 (1) NCT02296125 (1) NCT03656627 (1) NCT01474551 (1) NCT04142554 (1) NCT01830244 (1) NCT01503164 (1) NCT04077892 (1) NCT02942095 (1) NCT00056550 (1) NCT00503971 (1) NCT03300115 (1) NCT04547946 (1) NCT04581824 (1) NCT02873832 (1) NCT02835599 (1) NCT03064516 (1) NCT00660361 (1) NCT03341494 (1) NCT04220801 (1) NCT04623775 (1) NCT04190628 (1) NCT03840915 (1) NCT03090815 (1) NCT00888134 (1) NCT01019655 (1) NCT03219970 (1) NCT02824458 (1) NCT02170961 (1) NCT00903292 (1) NCT01121575 (1) NCT00040157 (1) NCT00542789 (1) NCT02036177 (1) NCT00470171 (1) NCT01120262 (1) NCT00000912 (1) NCT01550380 (1) NCT04239443 (1) NCT01009814 (1) NCT04001803 (1) NCT00931762 (1) NCT00840190 (1) NCT02330367 (1) NCT00788762 (1) NCT02274337 (1) NCT02720822 (1) NCT00471497 (1) NCT00381654 (1) NCT02169973 (1) NCT01207440 (1) NCT01528085 (1) NCT03982134 (1) NCT02088645 (1) NCT01573494 (1) NCT04644211 (1) NCT03085485 (1) NCT03457220 (1) NCT01928576 (1) NCT03135327 (1) NCT02134886 (1) NCT01497626 (1) NCT00797238 (1) NCT04042701 (1) NCT04006249 (1) NCT02293460 (1) NCT04260022 (1) NCT00160888 (1) NCT02343666 (1) NCT03821363 (1) NCT00378469 (1) NCT03879629 (1) NCT00135447 (1) NCT04297748 (1) NCT02264990 (1) NCT00453609 (1) NCT00068913 (1) NCT04142190 (1) NCT03922061 (1) NCT03356548 (1) NCT02575560 (1) NCT03226223 (1) NCT02531685 (1) NCT00260000 (1) NCT02365441 (1) NCT03762590 (1) NCT03553329 (1) NCT02972333 (1) NCT04056910 (1) NCT04689100 (1) NCT02296996 (1) NCT03151096 (1) NCT02416739 (1) NCT02987829 (1) NCT00565461 (1) NCT02484404 (1) NCT03399669 (1) NCT00730574 (1) NCT00342056 (1) NCT02342353 (1) NCT01259050 (1) NCT03153293 (1) NCT03870828 (1) NCT00041457 (1) NCT02250326 (1) NCT03732703 (1) NCT03396185 (1) NCT03707756 (1) NCT03179436 (1) NCT00737178 (1) NCT04602897 (1) NCT02427893 (1) NCT01648998 (1) NCT02208843 (1) NCT02263638 (1) NCT00299949 (1) NCT01795131 (1) NCT03328078 (1) NCT00625560 (1) NCT04364230 (1) NCT02930954 (1) NCT04425681 (1) NCT02218632 (1) NCT03262779 (1) NCT03855696 (1) NCT00897091 (1) NCT03690115 (1) NCT03186196 (1) NCT02230267 (1) NCT01121172 (1) NCT02115386 (1) NCT01682083 (1) NCT01975727 (1) NCT03113604 (1) NCT04292938 (1) NCT04669938 (1) NCT00866762 (1) NCT02140333 (1) NCT02642042 (1) NCT01854294 (1) NCT01541813 (1) NCT02179814 (1) NCT01730599 (1) NCT02888977 (1) NCT02454933 (1) NCT03693170 (1) NCT01227577 (1) NCT03990181 (1) NCT01134484 (1) NCT04061980 (1) NCT01998841 (1) NCT04413201 (1) NCT03051282 (1) NCT03785249 (1) NCT04619693 (1) NCT03363347 (1) NCT01560104 (1) NCT00222677 (1) NCT04617002 (1) NCT01549314 (1) NCT02601950 (1) NCT01592136 (1) NCT03292133 (1) NCT01723800 (1) NCT01274208 (1) NCT03223155 (1) NCT04677595 (1) NCT00405587 (1) NCT00110513 (1) NCT04044170 (1) NCT02448251 (1) NCT04088188 (1) NCT02601937 (1) NCT02991898 (1) NCT01357941 (1) NCT01848873 (1) NCT01922076 (1) NCT03284502 (1) NCT04117945 (1) NCT00592540 (1) NCT00879632 (1) NCT01353534 (1) NCT01437618 (1) NCT03631706 (1) NCT03595644 (1) NCT04276415 (1) NCT02640287 (1) NCT04546282 (1) NCT00260520 (1) NCT04685135 (1) NCT01439802 (1) NCT01503502 (1) NCT02266641 (1) NCT03943394 (1) NCT04000529 (1) NCT04011293 (1) NCT02484365 (1) NCT03282305 (1) NCT03558607 (1) NCT02555566 (1) NCT03660696 (1) NCT02642016 (1) NCT02416232 (1) NCT03178071 (1) NCT00335244 (1) NCT02888990 (1) NCT00907699 (1) NCT00171912 (1) NCT04646837 (1) NCT02079298 (1) NCT02095782 (1) NCT01387763 (1) NCT03921151 (1) NCT04333472 (1) NCT02520934 (1) NCT01631708 (1) NCT03942094 (1) NCT01697163 (1) NCT00972751 (1) NCT01860534 (1) NCT02504489 (1) NCT04438902 (1) NCT01719367 (1) NCT03132779 (1) NCT03859531 (1) NCT03831646 (1) NCT04487873 (1) NCT02214615 (1) NCT02078388 (1) NCT02690519 (1) NCT03705195 (1) NCT03455829 (1) NCT02260505 (1) NCT01352637 (1) NCT03169127 (1) NCT04322383 (1) NCT02639273 (1) NCT02763098 (1) NCT03551626 (1) NCT03106012 (1) NCT03092674 (1) NCT00154960 (1) NCT03653546 (1) NCT02553811 (1) NCT04098393 (1) NCT00070473 (1) NCT04606771 (1) NCT01618383 (1) NCT01351324 (1) NCT03711422 (1) NCT00129532 (1) NCT03885830 (1) NCT03731013 (1) NCT04507919 (1) NCT01956227 (1) NCT00362466 (1) NCT04534283 (1) NCT03227926 (1) NCT04233346 (1) NCT03991403 (1) NCT01594723 (1) NCT00772876 (1) NCT04138485 (1) NCT01105169 (1) NCT00593476 (1) NCT02576080 (1) NCT01699711 (1) NCT03916185 (1) NCT01877811 (1) NCT01949909 (1) NCT03140761 (1) NCT03492801 (1) NCT03475004 (1) NCT01875653 (1) NCT03977584 (1) NCT02979769 (1) NCT04324112 (1) NCT02398825 (1) NCT01523171 (1) NCT03235505 (1) NCT04140305 (1) NCT00827138 (1) NCT03943342 (1) NCT00632632 (1) NCT01349465 (1) NCT01641107 (1) NCT02815137 (1) NCT03405194 (1) NCT01888926 (1) NCT01108627 (1) NCT04525768 (1) NCT03787056 (1) NCT01275196 (1) NCT02633943 (1) NCT01513356 (1) NCT02350426 (1) NCT02143050 (1) NCT03198897 (1) NCT04541082 (1) NCT03975114 (1) NCT02786381 (1) NCT00896727 (1) NCT02707562 (1) NCT03349931 (1) NCT02842177 (1) NCT03482362 (1) NCT02469974 (1) NCT03721289 (1) NCT03812172 (1) NCT01730911 (1) NCT00752076 (1) NCT04467853 (1) NCT04603885 (1) NCT02468661 (1) NCT01105351 (1) NCT01599364 (1) NCT00126880 (1) NCT00986765 (1) NCT04553081 (1) NCT01259817 (1) NCT01859182 (1) NCT03444090 (1) NCT03190941 (1) NCT03804528 (1) NCT02145234 (1) NCT04006301 (1) NCT03312634 (1) NCT00001721 (1) NCT04120454 (1) NCT02652780 (1) NCT00559026 (1) NCT01955421 (1) NCT03423186 (1) NCT03783975 (1) NCT03207009 (1) NCT03275597 (1) NCT00757783 (1) NCT02672358 (1) NCT00948467 (1) NCT02331966 (1) NCT01738867 (1) NCT02652767 (1) NCT02303041 (1) NCT03874455 (1) NCT02855047 (1) NCT02419287 (1) NCT01667562 (1) NCT02766335 (1) NCT03349983 (1) NCT04278027 (1) NCT03941782 (1) NCT01189435 (1) NCT04242069 (1) NCT03727867 (1) NCT01639092 (1) NCT02146118 (1) NCT00003970 (1) NCT00190177 (1) NCT02025829 (1) NCT02052193 (1) NCT03126799 (1) NCT01949194 (1) NCT02847429 (1) NCT04425187 (1) NCT01121419 (1) NCT03227029 (1) NCT04438005 (1) NCT04329325 (1) NCT00570297 (1) NCT04624373 (1) NCT02043223 (1) NCT03348631 (1) NCT03861156 (1) NCT01660906 (1) NCT02455362 (1) NCT01326741 (1) NCT04338243 (1) NCT03206112 (1) NCT00606307 (1) NCT00586651 (1) NCT03217253 (1) NCT00700414 (1) NCT03325517 (1) NCT02247687 (1) NCT01141023 (1) NCT00603265 (1) NCT02099214 (1) NCT04655092 (1) NCT02949843 (1) NCT03853551 (1) NCT00130078 (1) NCT01043874 (1) NCT03647657 (1) NCT01377025 (1) NCT03581292 (1) NCT04487080 (1) NCT00867334 (1) NCT04285671 (1) NCT03422237 (1) NCT03415126 (1) NCT03136562 (1) NCT03770273 (1) NCT02953522 (1) NCT00879307 (1) NCT03217669 (1) NCT01413685 (1) NCT04487093 (1) NCT02311998 (1) NCT02146963 (1) NCT01534897 (1) NCT03466268 (1) NCT01181505 (1) NCT00562276 (1) NCT01941654 (1) NCT02877212 (1) NCT01136967 (1) NCT02064569 (1) NCT03760458 (1) NCT02651844 (1) NCT04585035 (1) NCT01942993 (1) NCT02284633 (1) NCT03608046 (1) NCT03420079 (1) NCT04330326 (1) NCT00802841 (1) NCT01470209 (1) NCT03457337 (1) NCT04483947 (1) NCT02097472 (1) NCT01411046 (1) NCT01992029 (1) NCT02391623 (1) NCT03594162 (1) NCT01096368 (1) NCT02227693 (1) NCT03122366 (1) NCT01345877 (1) NCT02451852 (1) NCT02886195 (1) NCT01720758 (1) NCT00493103 (1) NCT03585686 (1) NCT04084249 (1) NCT03962647 (1) NCT01734915 (1) NCT03272464 (1) NCT00813514 (1) NCT03787992 (1) NCT02101684 (1) NCT02206763 (1) NCT00553332 (1) NCT01040338 (1) NCT03459534 (1) NCT01950585 (1) NCT01540253 (1) NCT02596113 (1) NCT00880321 (1) NCT00028366 (1) NCT03309462 (1) NCT00540046 (1) NCT01881984 (1) NCT03016377 (1) NCT00000838 (1) NCT01173913 (1) NCT02625519 (1) NCT02649972 (1) NCT03854474 (1) NCT02600260 (1) NCT03472508 (1) NCT03023904 (1) NCT01368523 (1) NCT02960230 (1) NCT02122588 (1) NCT04250545 (1) NCT00262327 (1) NCT00335868 (1) NCT02357732 (1) NCT01717105 (1) NCT00533754 (1) NCT03285750 (1) NCT03377556 (1) NCT01584297 (1) NCT03227861 (1) NCT01583322 (1) NCT02106546 (1) NCT02114177 (1) NCT00285909 (1) NCT01740297 (1) NCT02323100 (1) NCT00280215 (1) NCT01089101 (1) NCT03435939 (1) NCT00957411 (1) NCT02370329 (1) NCT02489903 (1) NCT02956993 (1) NCT04539678 (1) NCT04146181 (1) NCT00875342 (1) NCT02161380 (1) NCT03765775 (1) NCT01283048 (1) NCT04590833 (1) NCT01276743 (1) NCT01402609 (1) NCT02052934 (1) NCT02428543 (1) NCT02311569 (1) NCT01283035 (1) NCT03720873 (1) NCT03189030 (1) NCT02252146 (1) NCT00623220 (1) NCT03176199 (1) NCT00878826 (1) NCT00740545 (1) NCT01871740 (1) NCT02037308 (1) NCT02819804 (1) NCT03455556 (1) NCT03203850 (1) NCT01400451 (1) NCT03718104 (1) NCT01719250 (1) NCT04634994 (1) NCT00216099 (1) NCT04229537 (1) NCT03794297 (1) NCT04271072 (1) NCT01524549 (1) NCT01769911 (1) NCT02454842 (1) NCT03213652 (1) NCT01762046 (1) NCT02569827 (1) NCT03406104 (1) NCT02906202 (1) NCT03877055 (1) NCT03117049 (1) NCT04527666 (1) NCT02989857 (1) NCT01586403 (1) NCT01659151 (1) NCT02504346 (1) NCT02725333 (1) NCT02323126 (1) NCT04426825 (1) NCT01069939 (1) NCT02514174 (1) NCT01227889 (1) NCT01699698 (1) NCT02906696 (1) NCT00878891 (1) NCT03647592 (1) NCT03615105 (1) NCT01013987 (1) NCT04549428 (1) NCT03865082 (1) NCT01670396 (1) NCT03568773 (1) NCT04620330 (1) NCT01352585 (1) NCT02865304 (1) NCT00957476 (1) NCT02186236 (1) NCT01594476 (1) NCT00684307 (1) NCT00005332 (1) NCT02428101 (1) NCT01045525 (1) NCT04609566 (1) NCT02311140 (1) NCT02322255 (1) NCT01744665 (1) NCT01951924 (1) NCT01893554 (1) NCT01390818 (1) NCT01816984 (1) NCT04452877 (1) NCT03225664 (1) NCT02339922 (1) NCT01067781 (1) NCT01858389 (1) NCT03381274 (1) NCT03007043 (1) NCT00874419 (1) NCT00405054 (1) NCT01466660 (1) NCT00873574 (1) NCT03754244 (1) NCT00255658 (1) NCT03845920 (1) NCT02200562 (1) NCT04391283 (1) NCT02722668 (1) NCT00966771 (1) NCT03549689 (1) NCT04489706 (1) NCT04120883 (1) NCT02151981 (1) NCT01002898 (1) NCT02857270 (1) NCT02109653 (1) NCT02960607 (1) NCT01707290 (1) NCT04499989 (1) NCT04043338 (1) NCT03020004 (1) NCT03523065 (1) NCT00723567 (1) NCT00899743 (1) NCT02060526 (1) NCT01362348 (1) NCT03944356 (1) NCT00694161 (1) NCT00522145 (1) NCT03224767 (1) NCT04194203 (1) NCT01669811 (1) NCT03788460 (1) NCT04388904 (1) NCT04075396 (1) NCT02151526 (1) NCT03595917 (1) NCT04092725 (1) NCT01264380 (1) NCT03698318 (1) NCT04104399 (1) NCT03158389 (1) NCT04526782 (1) NCT01254188 (1) NCT02870244 (1) NCT03745326 (1) NCT03911440 (1) NCT00003567 (1) NCT01504542 (1) NCT04480918 (1) NCT00747994 (1) NCT03621865 (1) NCT01281722 (1) NCT02410863 (1) NCT00463385 (1) NCT03243461 (1) NCT01665417 (1) NCT02779530 (1) NCT01837017 (1) NCT02789345 (1) NCT02488694 (1) NCT02924935 (1) NCT03612908 (1) NCT03736837 (1) NCT03110822 (1) NCT03130894 (1) NCT02380157 (1) NCT03818763 (1) NCT02480725 (1) NCT02534168 (1) NCT01259856 (1) NCT04151563 (1) NCT01745120 (1) NCT00595517 (1) NCT02463383 (1) NCT02425904 (1) NCT03965689 (1) NCT04258956 (1) NCT02953496 (1) NCT04034459 (1) NCT03778229 (1) NCT01750918 (1) NCT03386942 (1) NCT03862885 (1) NCT01038856 (1) NCT02631876 (1) NCT01233219 (1) NCT04643847 (1) NCT01597908 (1) NCT03859245 (1) NCT02609984 (1) NCT04592666 (1) NCT04442672 (1) NCT02885766 (1) NCT00854841 (1) NCT04034446 (1) NCT04206072 (1) NCT00607581 (1) NCT01956786 (1) NCT00893178 (1) NCT04640324 (1) NCT04196413 (1) NCT00806325 (1) NCT00364728 (1) NCT04439279 (1) NCT01705847 (1) NCT02561988 (1) NCT04123626 (1) NCT03417830 (1) NCT02922296 (1) NCT01243372 (1) NCT03453918 (1) NCT00513110 (1) NCT04165031 (1) NCT04225429 (1) NCT01006980 (1) NCT00352053 (1) NCT02338011 (1) NCT04360005 (1) NCT02777567 (1) NCT04591002 (1) NCT02367859 (1) NCT03647956 (1) NCT04293562 (1) NCT02628314 (1) NCT03303833 (1) NCT01460134 (1) NCT02929706 (1) NCT03342170 (1) NCT04042558 (1) NCT02626130 (1) NCT03232307 (1) NCT00435513 (1) NCT02317562 (1) NCT01391260 (1) NCT02561533 (1) NCT01980550 (1) NCT00092404 (1) NCT03758677 (1) NCT01001273 (1) NCT03438318 (1) NCT02422797 (1) NCT02318407 (1) NCT02538926 (1) NCT02615015 (1) NCT01284712 (1) NCT04316351 (1) NCT03091491 (1) NCT01740648 (1) NCT01866410 (1) NCT01175161 (1) NCT01602939 (1) NCT04330664 (1) NCT01701037 (1) NCT03612869 (1) NCT00753480 (1) NCT00090688 (1) NCT03590522 (1) NCT01717404 (1) NCT02937727 (1) NCT03899857 (1) NCT04133870 (1) NCT03790397 (1) NCT03024281 (1) NCT03389256 (1) NCT04681001 (1) NCT03426371 (1) NCT02926638 (1) NCT04193553 (1) NCT00997334 (1) NCT04544202 (1) NCT04201457 (1) NCT00618631 (1) NCT04455594 (1) NCT03439215 (1) NCT02164916 (1) NCT02000882 (1) NCT03264794 (1) NCT03810066 (1) NCT01897116 (1) NCT04372498 (1) NCT00125489 (1) NCT02788669 (1) NCT00367952 (1) NCT00977756 (1) NCT03387072 (1) NCT01586195 (1) NCT02611492 (1) NCT01220648 (1) NCT01967940 (1) NCT01708954 (1) NCT03758287 (1) NCT02392871 (1) NCT04401059 (1) NCT02869932 (1) NCT00716014 (1) NCT01526928 (1) NCT00930215 (1) NCT04631172 (1) NCT03228667 (1) NCT04273581 (1) NCT04557956 (1) NCT00980018 (1) NCT01898039 (1) NCT03883087 (1) NCT04364451 (1) NCT04216524 (1) NCT04204551 (1) NCT03672968 (1) NCT03924050 (1) NCT03983252 (1) NCT01639872 (1) NCT02747277 (1) NCT04116918 (1) NCT00669396 (1) NCT02153398 (1) NCT03543306 (1) NCT01377376 (1) NCT01603446 (1) NCT01534520 (1) NCT01972529 (1) NCT01731704 (1) NCT04186377 (1) NCT01424475 (1) NCT02066636 (1) NCT02467270 (1) NCT01748149 (1) NCT02092909 (1) NCT02864251 (1) NCT03846427 (1) NCT03779191 (1) NCT00055848 (1) NCT01217437 (1) NCT04088734 (1) NCT03191786 (1) NCT01450319 (1) NCT04689347 (1) NCT03652090 (1) NCT00995553 (1) NCT01833572 (1) NCT00432900 (1) NCT03553563 (1) NCT01878006 (1) NCT03357627 (1) NCT03668431 (1) NCT03832257 (1) NCT02739243 (1) NCT01193881 (1) NCT02427620 (1) NCT03784599 (1) NCT02055976 (1) NCT02147990 (1) NCT01400074 (1) NCT01551030 (1) NCT00617708 (1) NCT00050180 (1) NCT00283387 (1) NCT03310541 (1) NCT00931944 (1) NCT02730884 (1) NCT02717455 (1) NCT04666259 (1) NCT00532792 (1) NCT04099836 (1) NCT02375022 (1) NCT03709706 (1) NCT02074696 (1) NCT00020787 (1) NCT01739231 (1) NCT04634695 (1) NCT04399551 (1) NCT02590952 (1) NCT02063971 (1) NCT04254419 (1) NCT04654689 (1) NCT01683175 (1) NCT03373370 (1) NCT00814073 (1) NCT02417740 (1) NCT03374215 (1) NCT02783300 (1) NCT03053219 (1) NCT01595425 (1) NCT04128878 (1) NCT01101438 (1) NCT02580708 (1) NCT00769067 (1) NCT03764553 (1) NCT03344809 (1) NCT04009148 (1) NCT02094222 (1) NCT02178722 (1) NCT03452150 (1) NCT04390243 (1) NCT00751777 (1) NCT04676477 (1) NCT02404441 (1) NCT00173069 (1) NCT02311478 (1) NCT01339052 (1) NCT04059874 (1) NCT01833143 (1) NCT00270556 (1) NCT02746341 (1) NCT02977780 (1) NCT02770014 (1) NCT01728025 (1) NCT03866499 (1) NCT03107156 (1) NCT01172509 (1) NCT01822496 (1) NCT04171284 (1) NCT03856697 (1) NCT03648372 (1) NCT03020797 (1) NCT02705846 (1) NCT04552769 (1) NCT00428441 (1) NCT02690324 (1) NCT03521154 (1) NCT01453036 (1) NCT01937325 (1) NCT04206787 (1) NCT04230473 (1) NCT04528680 (1) NCT02383524 (1) NCT01663545 (1) NCT04083976 (1) NCT01754376 (1) NCT04655976 (1) NCT01262482 (1) NCT01074177 (1) NCT00634673 (1) NCT02141464 (1) NCT01999985 (1) NCT02670707 (1) NCT01363570 (1) NCT01586520 (1) NCT03067415 (1) NCT03173820 (1) NCT01487291 (1) NCT00155207 (1) NCT02630264 (1) NCT03257124 (1) NCT01744561 (1) NCT01872780 (1) NCT02762877 (1) NCT04262466 (1) NCT02655536 (1) NCT01139970 (1) NCT02785939 (1) NCT00588263 (1) NCT03919071 (1) NCT01435655 (1) NCT03236675 (1) NCT00668421 (1) NCT03224208 (1) NCT02429791 (1) NCT01711632 (1) NCT03521596 (1) NCT02274012 (1) NCT03101813 (1) NCT03701815 (1) NCT00029627 (1) NCT03001609 (1) NCT01141829 (1) NCT04148898 (1) NCT00443612 (1) NCT02081378 (1) NCT00612898 (1) NCT03972943 (1) NCT04667988 (1) NCT04644887 (1) NCT02785952 (1) NCT00708929 (1) NCT03615443 (1) NCT03548220 (1) NCT01756118 (1) NCT03807778 (1) NCT00671138 (1) NCT00749853 (1) NCT01582997 (1) NCT00815321 (1) NCT01398644 (1) NCT03236610 (1) NCT03053297 (1) NCT02590588 (1) NCT02125357 (1) NCT00245986 (1) NCT04505956 (1) NCT01341743 (1) NCT01339442 (1) NCT02833194 (1) NCT02403193 (1) NCT02630212 (1) NCT02408887 (1) NCT00647946 (1) NCT04396860 (1) NCT01237522 (1) NCT02474355 (1) NCT01761968 (1) NCT03731260 (1) NCT04311034 (1) NCT02091141 (1) NCT01063933 (1) NCT03890198 (1) NCT01789060 (1) NCT03168074 (1) NCT03215706 (1) NCT03588273 (1) NCT02387957 (1) NCT01299337 (1) NCT04148066 (1) NCT03046992 (1) NCT02422719 (1) NCT00173446 (1) NCT02754362 (1) NCT03160105 (1) NCT02782403 (1) NCT02838420 (1) NCT01159145 (1) NCT00794885 (1) NCT04410796 (1) NCT04358562 (1) NCT04143607 (1) NCT04306926 (1) NCT01810965 (1) NCT00433862 (1) NCT00949702 (1) NCT01744171 (1) NCT02314143 (1) NCT02713880 (1) NCT02199613 (1) NCT00687518 (1) NCT02923986 (1) NCT04325698 (1) NCT01014546 (1) NCT04568239 (1) NCT01700582 (1) NCT00672035 (1) NCT03115164 (1) NCT01068327 (1) NCT00464113 (1) NCT01933347 (1) NCT03452592 (1) NCT02186301 (1) NCT01120964 (1) NCT01791309 (1) NCT04629209 (1) NCT00644878 (1) NCT02550990 (1) NCT02965378 (1) NCT03842969 (1) NCT03952052 (1) NCT04484142 (1) NCT01396408 (1) NCT01274091 (1) NCT02412943 (1) NCT02117336 (1) NCT04673331 (1) NCT04607421 (1) NCT01861223 (1) NCT00089297 (1) NCT00570583 (1) NCT01245556 (1) NCT03087071 (1) NCT02292732 (1) NCT02034110 (1) NCT03716908 (1)

SNPMiner SNPMiner Trials (Home Page)


Report for Clinical Trial NCT04667988

Developed by Shray Alag, 2020-2021.
SNP Clinical Trial Gene

JAK2 Mutation May Predict Response and Guide First Line Treatment in Rheumatoid Arthritis

This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.

NCT04667988 Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression
MeSH:Arthritis Arthritis, Rheumatoid
HPO:Arthritis Polyarticular arthritis Rheumatoid arthritis

1 Interventions

Name: JAK expression

Description: JAK2 assessment in blood by PCR
Type: Diagnostic Test
Group Labels: 2

RA patients control


Primary Outcomes

Description: Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.

Measure: JAK2 mutation expression in newly diagnosed RA patients

Time: 6 months

Purpose: Other

Allocation: Non-Randomized

Single Group Assignment


There is one SNP

SNPs


1 V617F

Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.. Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression Arthritis Arthritis, Rheumatoid PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker: The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). --- V617F ---

Impact of pretreatment JAK2 mutation on response of Rheumatoid Arthritis patients to first line csDMARDS.. Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Inclusion Criteria: - New case RA patients - good liver and renal function Exclusion Criteria: - Other autoimmune diss - Malignancy - Active viral infection - pregnancy and lactation Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression Arthritis Arthritis, Rheumatoid PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker: The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). --- V617F --- --- V617F ---



HPO Nodes


HPO:
HP:0001369: Arthritis
Genes 273
NLRP3 PSMB4 ACP5 SLC37A4 PTPN22 MIR140 LMNA HGD COL1A1 MMP13 FRZB MMP14 COL9A3 NTRK1 ARVCF PTPN22 LMX1B HPRT1 GBA HLA-C PFKM ABCG8 TNFRSF1A IL2RB RREB1 NLRP3 HPGD TF BTK JMJD1C COPA COL2A1 PIK3CD EXT1 COMP TBX1 IL12B STAT4 TNFRSF11B IL10 TBX1 GJB6 LRP6 IL2RA TRPV4 MUC1 WIPF1 COMP MMP13 GJB2 PSTPIP1 RNASEH2C HPRT1 DCLRE1C HIRA GP1BB TRAPPC2 IRF5 IL6 ATP7B EPCAM CLCN7 SEC24C HJV IL36RN COL3A1 KIF7 SLC37A4 GHR NLRP12 STAT4 SPTA1 MLX COL11A1 SLC40A1 HPGD PTPN2 SMAD3 IGLL1 COL9A1 PTPN22 SLC22A4 FGFR3 COL2A1 UMOD CCN6 IDS TCF3 PRPS1 IGHM MYH14 CD79A PIK3R1 FASLG COL1A1 HNF1B CD79B NLRP3 ASAH1 HLA-DRB1 PRKCD ANKRD55 HLA-B COL5A1 CCR6 DNAJB11 COL2A1 MATN3 IL23R KNSTRN GLA F8 PTPN22 RAG1 RNF168 COL5A1 PTPN2 COL11A2 TREX1 TFR2 COL11A2 SLC26A2 UMOD SLC12A3 FAS CD247 EPB42 VPS13A EXT2 NOD2 COL11A2 CLCN7 NOD2 HGD ZNF687 CLCNKB FCGR2B TLR4 IL2RA MVK COMP CTLA4 TREX1 MEFV CAV1 IFIH1 ANKRD55 WAS AGA MATN3 NLRP3 CFI FAS COL9A2 SAMHD1 UFD1 SH3KBP1 HNF1B ASAH1 LACC1 G6PC1 TNFRSF1A MEFV TRAPPC2 CASP10 ANKH STAT4 UFSP2 TRPV4 SMAD3 COL2A1 MYD88 GPR101 IRAK1 C4A HPRT1 ZMPSTE24 ACAN STAT4 CCR1 GCH1 UBAC2 BTK HFE CD247 AIP HPGD MEFV ACAN UFSP2 RNASEH2B FAS PSMB9 MTHFD1 COL2A1 GDF5 PSTPIP1 SLC4A1 RAG2 PADI4 OCRL PHEX COL9A1 COL9A3 MIF ANKH ERAP1 KIF22 SCARB2 SPP1 CANT1 MMP2 ADA2 LBR HLA-DRB1 PTPN22 FOXP3 PRPS1 CCN6 ADAR IL2RB NLRP3 GNAS COMP COL2A1 HPRT1 FBN1 KLRC4 DNASE1 ACP5 PHEX HLA-B RNASEH2A LEMD3 HOXD10 SPTB BTK HNF4A DNASE1L3 RASGRP1 ATP7B IL10 ASPN HLA-DRB1 PRKCD MVK LRRC8A IL12A-AS1 APOE ACAN LRBA AEBP1 CCN2 CIITA COMT BLNK SEC61A1 COL9A2 ANK1 COL5A2 CTLA4 PRG4 MATN3 IL12A CD244 TGFB3 FCGR2A F9 NFKBIL1 SLCO2A1 TRPS1 HLA-B IDS
Protein Mutations 4
A147T N363S R620W V600E