SNPMiner Trials by Shray Alag


SNPMiner SNPMiner Trials (Home Page)


Report for Mutation V66M

Developed by Shray Alag, 2020.
SNP Clinical Trial Gene

There are 44 clinical trials

Clinical Trials


1 Combined Exposure Therapy and D-Cycloserine vs. Placebo for Posttraumatic Stress Disorder

This study proposes to evaluate the effects of D-cycloserine (DCS) combined with Virtual Reality exposure therapy in a sample of patients who developed posttraumatic stress disorder (PTSD) following either the events of September 11, 2001, or military service in the war in Iraq. In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF (Val66Met), predicts treatment response to PTSD. Overall, this study aims 1) to determine if subjects administered DCS show a significantly larger decrease in symptoms of PTSD as compared to those administered a placebo, 2) to determine if subjects administered DCS show a decrease in PTSD symptomatology significantly earlier (as measured by weeks) than those administered a placebo, 3) to determine if differences in symptomatology are evident at a 6-month follow-up and indicate long-term differences between groups, and 4) to determine if the BDNF SNP predicts treatment response.

NCT00632632 Posttraumatic Stress Disorder Drug: D-Cycloserine Other: Placebo
MeSH: Stress Disorders, Traumatic Stress Disorders, Post-Traumatic

In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF (Val66Met), predicts treatment response to PTSD. --- Val66Met ---

Primary Outcomes

Description: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)

Measure: Clinician Administered PTSD Scale(CAPS)

Time: Immediately following treatment

Description: Total CAPS severity score range is 0-136. Higher values represent a worse outcome (i.e. greater severity of posttraumatic symptoms). CAPS consists of 3 subscales, which are combined to form a total severity score. Subscales: CAPS cluster B (reexperiencing symptoms, range 0-40) CAPS cluster C (avoidance and numbing symptoms, range 0-56) CAPS cluster D (hyperarousal symptoms, range 0-40)

Measure: Clinician Administered PTSD Scale(CAPS)

Time: 6-months follow-up

Secondary Outcomes

Description: Structured Clinical Interview for DSM-IV - Major Depressive Disorder is a clinical interview to assess presence/absence of Major Depressive Disorder.

Measure: Structured Clinical Interview for DSM-IV - Major Depressive Disorder (SCID-MDD)

Time: Immediately following treatment

2 D-cycloserine Enhanced Imaginal ExposureTherapy for Posttraumatic Stress Disorder (PTSD)

This study proposes to evaluate the effects of D-cycloserine (DCS) combined with cognitive-behavioral treatment with exposure therapy in a sample of patients who developed posttraumatic stress disorder (PTSD) as a consequence of various traumas (e.g., motor vehicle and accidents, burns and other injuries, combat, World Trade Center attack, etc.). In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF SNP (Val66Met), predicts treatment response to PTSD. Patients living in areas that are not geographically proximal to the Weill-Cornell Medical Center New York City campus will receive cognitive behavioral therapy using telemedicine (videoconferencing technology). Overall, this study aims 1) to determine if subjects administered DCS show a significantly larger decrease in symptoms of PTSD as compared to those administered a placebo, 2) to determine if subjects administered DCS show a decrease in PTSD symptomatology significantly earlier (as measured by weeks) than those administered a placebo, 3) to determine if differences in symptomatology are evident at a 6-month follow-up and indicate long-term differences between groups, 4) to determine if the BDNF SNP predicts treatment response, 5)to determine if it is feasible and acceptable to provide imaginal exposure (IE) therapy for PTSD using videoconferencing technology.

NCT00875342 Posttraumatic Stress Disorder Drug: DCS Other: Placebo
MeSH: Stress Disorders, Traumatic Stress Disorders, Post-Traumatic

In addition, this study hopes to determine whether a common human genetic single nucleotide polymorphism (SNP) in a growth factor, brain derived neurotrophic factor, BDNF SNP (Val66Met), predicts treatment response to PTSD. --- Val66Met ---

In addition, all participants will be genotyped once for the BDNF SNP (Val66Met) using a non-invasive saliva sample. --- Val66Met ---

Primary Outcomes

Measure: symptoms of Posttraumatic Stress Disorder-Clinician Administered PTSD Scale(CAPS) and PCL

Time: At initial assessment, during treatment, immediately following treatment, and 6 months after completion of treatment

Secondary Outcomes

Measure: Other measures include BDI, BSI, STAXI-2, Expectancy of Therapeutic Outcomes

Time: At initial assessment, during treatment, immediately following treatment, and 6 months after completion of treatment

3 Brain Derived Neurotrophic Factor as a Predictor of Response to Treatment in Bipolar Depression and Mania: 16-weeks Follow-up With Quetiapine XR

There is sound evidence that quetiapine is effective in the treatment of manic and depressive episodes associated with Bipolar Disorder (BD) (Yatham et al 2006). However, even with the development of effective new treatment options, not all patients respond to treatments available. Biological markers have been investigated as predictors of response to treatment and of remission of symptoms. This would explain in part the individual's differences in the response to treatment, taking into account the genetic variability plus environmental factors influencing specific biological markers. A potential biological marker of response to treatment in BD would be the levels of neurotrophins, as they are, in fact, altered during acute mood episodes (Cunha et al 2006). Among neurotrophins, the Brain-Derived Neurotrophic Factor (BDNF) has been repeatedly and consistently reported to be associated with BD physiopathology (Post 2007). Furthermore, medications that are known to be effective in BD, like lithium and divalproex, increase BDNF levels.

NCT00879307 BIPOLAR DISORDER Drug: quetiapine
MeSH: Depression Bipolar Disorder
HPO: Bipolar affective disorder Mania

Interestingly, a single nucleotide polymorphism at nucleotide196 (G/A) in the human BDNF gene at codon 66 (Val66Met) have been reported to be associated with a predisposition to BD in family-based studies (Rybakowski et al 2006, Green et al 2006). --- Val66Met ---

Furthermore, there are consistent findings in BD regarding the association of Val66Met polymorphism of BDNF gene with prefrontal cognitive impairment, which was recently confirmed in a large sample of bipolar subjects (Rybakowski et al 2006). --- Val66Met ---

In addition, crosssectional studies showed that the polymorphism of BDNF gene (Val66Met) was associated with response to lithium prophylaxis, but findings were not universal (Rybakowski et al 2005, Masui et al 2006). --- Val66Met ---

We also aim to investigate the polymorphism of BDNF gene (Val66Met) and its correlation with BDNF serum levels and treatment response. --- Val66Met ---

Primary Outcomes

Measure: Efficacy of quetiapine as a treatment for acute mania and depression, and of as a manutence treatment.

Time: 16 weeks

Secondary Outcomes

Measure: Assess the pharmacodynamics of quetiapine by neurotrophins in blood samples.

Time: 16 weeks

4 Brain Derived Neurotrophic Factor as a Predictor of Response to Treatment in Bipolar Depression and Mania: 16-weeks Follow-up Study

There is sound evidence that quetiapine is effective in the treatment of manic and depressive episodes associated with Bipolar Disorder (BD) (Yatham et al 2006). However, even with the development of effective new treatment options, not all patients respond to treatments available. Biological markers have been investigated as predictors of response to treatment and of remission of symptoms. This would explain in part the individual's differences in the response to treatment, taking into account the genetic variability plus environmental factors influencing specific biological markers. A potential biological marker of response to treatment in BD would be the levels of neurotrophins, as they are, in fact, altered during acute mood episodes (Cunha et al 2006). Among neurotrophins, the Brain-Derived Neurotrophic Factor (BDNF) has been repeatedly and consistently reported to be associated with BD physiopathology (Post 2007). Furthermore, medications that are known to be effective in BD, like lithium and divalproex, increase BDNF levels.

NCT00879632 BIPOLAR DISORDER
MeSH: Depression Bipolar Disorder
HPO: Bipolar affective disorder Mania

Interestingly, a single nucleotide polymorphism at nucleotide196 (G/A) in the human BDNF gene at codon 66 (Val66Met) have been reported to be associated with a predisposition to BD in family-based studies (Rybakowski et al 2006, Green et al 2006). --- Val66Met ---

Furthermore, there are consistent findings in BD regarding the association of Val66Met polymorphism of BDNF gene with prefrontal cognitive impairment, which was recently confirmed in a large sample of bipolar subjects (Rybakowski et al 2006). --- Val66Met ---

In addition, crosssectional studies showed that the polymorphism of BDNF gene (Val66Met) was associated with response to lithium prophylaxis, but findings were not universal (Rybakowski et al 2005, Masui et al 2006). --- Val66Met ---

We also aim to investigate the polymorphism of BDNF gene (Val66Met) and its correlation with BDNF serum levels and treatment response. --- Val66Met ---

Primary Outcomes

Measure: Hamilton depression raing scale and young mania rating scale

Time: 16 weeks

Secondary Outcomes

Measure: Serum BDNF levels as predictor of response to treatment

Time: 16 weeks

5 Genetic Association Study Between Single Nucleotide Polymorphisms (SNPs) and Cognitive Performance in Young Bipolar Type I Patients: LICAVALGENE

This is a genetic association study of cognitive impairment in young bipolar disease type I patients without medications in mania, depression, hypomania or mixed states.

NCT00969930 Bipolar

Methods: 80 patients with BD type I (SCID DSM-IV), age from 18 to 35 years old, currently on mania, depression, hypomania or mixed state after medication wash out will be submitted to complete neuropsychological evaluation and genotyped for COMT (val158met, rs165599, -287, rs737865), ApoE (epsilon 4) and BDNF (val66met)and 80 healthy controls. --- val158met --- --- val66met ---

Primary Outcomes

Measure: Cognitive deficits in BD patients are associated with COMT, ApoE and BDNF polymorphisms

Time: 18 months

6 Transcranial Magnetic Stimulation (TMS) Measures of Plasticity and Excitatory/Inhibitory Ratio as Biomarkers for R-baclofen Effects in Normal Volunteers

Our overall objective is to apply Transcranial Magnetic Stimulation (TMS) to develop measures of human synaptic plasticity and of brain excitatory:inhibitory ratio (E:I ratio), which we propose as novel biomarkers and outcome measures that will expedite clinical trials of treatments for Autism Spectrum Disorder (ASD). One potential therapeutic agent, R-baclofen will be investigated under this protocol. TMS is a safe, inexpensive and noninvasive means to focally stimulate the human brain. Presently, TMS is in extensive use as a means to measure regional brain excitability, which is dependent on local synaptic strength. TMS can be used to temporarily alter synaptic strength as well as to acutely measure levels of cortical excitability and short and long interval inhibition. Since altered synaptic plasticity and an imbalanced inhibitory:excitatory ratio are cited as fundamental abnormalities in ASD, we hypothesize that both severity of ASD-related learning deficits and their improvement after therapy will correlate with TMS measures of synaptic plasticity and E:I ratio. We propose to embed TMS measures of synaptic plasticity and E:I ratio in a 'Proof of Principal' trial of R-baclofen and to examine: Aim 1: Whether R-baclofen (a potential therapeutic agent for ASD) predictably alters TMS measures of synaptic plasticity and E:I ratio as a function of plasma concentration in adult volunteers. We will test the following hypotheses: 1. R-baclofen produces a significant change in TMS measures of LTD and E:I ratio; and 2. R-baclofen plasma levels and TMS measures of LTD and E:I ratio show a predictable exposure-response relationship. Exploratory Aim 1: Whether the presence of genetic polymorphisms of the BDNF and GABA-B receptor genes has a moderating effect on TMS measures and on R-baclofen effects. We will test the following hypotheses: 1. Presence of the BDNF val66met allele will be associated with decreased long-term depression (LTD) of cortical excitability 2. Polymorphisms of GABA-B receptor genes will be associated with altered magnitude of response to R-baclofen as measured by TMS

NCT01172509 Autism Drug: R-baclofen

We will test the following hypotheses: 1. Presence of the BDNF val66met allele will be associated with decreased long-term depression (LTD) of cortical excitability 2. Polymorphisms of GABA-B receptor genes will be associated with altered magnitude of response to R-baclofen as measured by TMS percent of baseline TMS-induced measures of (1) human synaptic plasticity (LTD). --- val66met ---

Primary Outcomes

Description: Synaptic plasticity or LTD will be measured using the MEP in response to stimulation set at 80% of the active motor threshold. This MEP will be measured at 90 minutes after study drug dose to establish baseline MEP amplitude then LTD will be induced with the cTBS procedure. The amount of LTD remaining at the different time points, post-cTBS will be quantified by measuring the MEPs and dividing it by the baseline MEP. This will yield a percent of baseline MEP at the various time points.

Measure: percent of baseline TMS-induced measures of (1) human synaptic plasticity (LTD)

Time: at 90 minutes after study drug dose

7 Enhancing Exposure Therapy for PTSD: Virtual Reality and Imaginal Exposure With a Cognitive Enhancer

The purpose of this study is to test the differences between four active treatment conditions for combat-related Post Traumatic Stress Disorder (PTSD): virtual reality exposure therapy (VRE) or prolonged imaginal exposure therapy (PE), both with DCS or placebo, as well as to examine predictors for PTSD and response to treatment in active duty military personnel, veterans, and civilians who served in Iraq and Afghanistan.

NCT01352637 Post Traumatic Stress Disorder Drug: DCS (D-Cycloserine ) + Prolonged Imaginal Exposure Drug: DCS (D-Cycloserine ) + Virtual Reality Exposure Drug: Placebo + Prolonged Imaginal Exposure Drug: Placebo (sugar pill) + Virtual Reality Exposure
MeSH: Stress Disorders, Traumatic Stress Disorders, Post-Traumatic

heart rate, blood pressure) and/or a genetic polymorphism (BDNF Val66Met) obtained from a saliva sample will be examined. --- Val66Met ---

Primary Outcomes

Description: Clinician Administered PTSD Scale (CAPS) for the DSM-IV [34]. The CAPS-IV is a structured clinical interview designed to assess the 17 DSM-IV PTSD symptoms. CAPS-IV provides categorical ratings of diagnostic status as well as a quantitative index of symptom severity. The CAPS total severity score is based on response to the 17 items that assess the frequency and intensity of current PTSD symptoms. Symptom severity is assessed separately for past month and past week time frames. CAPS-IV range is 0-136, higher scores mean a worse outcome.

Measure: CAPS-IV at the End of Treatment

Time: after weekly treatment session 9 (at posttreatment assessment)

8 Motor Outcomes and Neural Correlates of Asymmetrical Gait Training in Children With Acquired Hemiplegia

The purposes of this pilot research study are 1. To begin to test if two different types of physical therapy might have different results in children and adolescents who have had a prior stroke, and 2. To determine if either type of physical therapy causes changes in the brain signals that control leg muscles. All participants will receive physical therapy 3 times per week for 8 weeks. Half of the participants will receive typical physical therapy, such as walking practice, muscle strengthening, and balance training. Half of the participants will receive asymmetrical gait training physical therapy, which uses new technology to train each leg differently during walking practice. After enrolling, participants will be randomly assigned to the type of therapy. Measurements will be taken before, during, and after the 8 weeks of physical therapy. These include walking tests to measure symmetry, walking speed and daily step activity, and brain tests to measure the strength of the signals from the brain to the leg muscles. One blood test is also taken to identify if certain genetic factors affect how each child responds to the physical therapy.

NCT01827436 Stroke Hemiplegia Behavioral: Conventional physical therapy Behavioral: Asymmetrical gait training
MeSH: Stroke Hemiplegia
HPO: Hemiplegia Spastic hemiparesis Stroke

We will also establish a genetic database to identify the presence or absence of two genetic variants [Apolipoprotein E (ApoE Є4) and val66met Brain-derived neurotropic factor (BDNF) polymorphisms] associated with decreased potential for neuroplasticity for planning future investigations. --- val66met ---

Primary Outcomes

Measure: Change in walking symmetry

Time: before and after 8 weeks of therapy

Secondary Outcomes

Measure: Change in walking speed

Time: before and after 8 weeks of therapy

Measure: Change in excitability of neural motor pathways

Time: before and after 8 weeks of therapy

Measure: Change in patient/parent satisfaction rating

Time: before and after 8 weeks of therapy

Measure: Change in community step activity

Time: before and after 8 weeks of therapy

Other Outcomes

Measure: Changes in walking ability and cortical excitability measures (detailed above)

Time: before and after a 4 week baseline phase; before and after a 4 week withdraw phase

9 Investigating the Plastic Effects of Repetitive Paired Associative Stimulation (rPAS) in Dystonia

Background: - People with dystonia have serious muscle contractions that cause abnormal movements or postures. This significantly affects their daily lives. The common type is called organic. The other type is psychogenic. People with this type have typical symptoms plus some psychological effects. Researchers will look at how rapid transcranial magnetic stimulation (rTMS) of the brain combined with stimulation of a nerve affects the ability to detect sensations. They will compare the responses of people with different types of dystonia. They will also compare the responses of people with dystonia to responses of people without it. This study may help us learn more about the nature of different types of dystonia. Objectives: - To see whether TMS combined with nerve stimulation affects the brain differently in people with different types of dystonia and those without dystonia. Eligibility: - Individuals at least 18 years old, who are right-handed and have dystonia. - Healthy volunteers at least 18 years old. Design: - Participants will have two clinical visits. Each visit will be a few hours long. They can be done on the same day. - Participants will be screened with a medical history and physical exam. - Participants will take several sensory tests. For these tests, electrodes will be placed on their skin. The participants will feel small electric shocks during some of the tests. - Participants will undergo TMS. For 2 minutes, quick electrical currents will pass through a wire coil placed on their head. As this happens, researchers will ask the participants to move certain muscles.

NCT01888926 Dystonia
MeSH: Dystonia Dystonic Disorders
HPO: Dystonia Focal dystonia Limb dystonia Paroxysmal dystonia Writer's cramp

Outcome Measures Primary outcome variable: Change in MEP amplitudes at T30 from baseline Secondary outcome variables: - Input-output curve parameters (measured at baseline, T0, T30, and T60) - Temporal discrimination threshold (TDT) Exploratory Measures - Short interval intracortical inhibition (SICI), a measure of inhibition in the motor cortex - Influence of Val66Met BDNF polymorphism on the output variables Repeated measures analyses of variance (ANOVA) will be used to investigate the following three factors on the outcome variables: time (four levels: baseline, T0, T30 and T60) and muscle (two levels: APB and FDI) as within-subject factor and group (three levels: organic dystonia, psychogenic dystonia, and healthy controls) as between-subjects factor. --- Val66Met ---

Primary Outcomes

Measure: Change from baseline in the motor evoked potential (MEP) amplitude at S50 after 30 minutes from rPAS (T30).

Time: 30 minutes from rPAS

10 Neuroimaging Predictors of Antidepressant Treatment Outcome

Current medical therapies for depression take weeks to achieve full efficacy, and are ineffective in many patients or cause intolerable side effects, emphasizing the need for a deeper understanding of depression and its treatment. Identifying early brain biomarkers of treatments responses seems necessary to improve antidepressant treatment outcome. In this study we aim to detect early brain responses to a fast acting antidepressant-like treatment administered intravenously during a Real-Time Neurofeedback functional magnetic resonance imaging (MRI) Task to predict antidepressant treatment outcome in depression. At completion of the neuroimaging task, participants will enter a placebo-controlled clinical trial with a selective serotonin reuptake inhibitor (SSRI).

NCT02000726 Depression Drug: Placebo Drug: Citalopram Drug: Fast acting antidepressant-like treatment. administered i.v. during the fMRI scanning session
MeSH: Depression

Inferential Reasoning (including cost-benefit analysis): Delayed Discounting of Money Rewards, Iowa Gambling Task, Common Difference effect gambling task and the WCST.. BDNF Val66Met single nucleotide polymorphism(SNP)genotyping. --- Val66Met ---

Primary Outcomes

Measure: Blood-oxygen-level dependent (BOLD) responses during the Real-Time Neurofeedback Task.

Time: BOLD responses will be assessed at baseline and depression severity will be assessed at baseline

Secondary Outcomes

Measure: Depression severity assessed with several depressive questionnaires.

Time: Every two weeks until the end of the trial (16 weeks total), or until the participants leave the study.

Other Outcomes

Description: Affect processing: Emotional Words Task and Facial Emotion Perception test. Attention and Inhibitory Control: Parametric Go/NoGo, Trail Making test and the Stroop Color Word test . Inferential Reasoning (including cost-benefit analysis): Delayed Discounting of Money Rewards, Iowa Gambling Task, Common Difference effect gambling task and the WCST.

Measure: Neuropsychological functioning of patients with depression

Time: At baseline

Description: 5ml of blood drawn per participants will be used for genotyping

Measure: BDNF Val66Met single nucleotide polymorphism(SNP)genotyping

Time: At baseline

11 The Effect of BDNF on Motor Learning

The purpose of the study is to assess the status of brain-derived neurotrophic factor brain (BDNF) and how the brain behaves in response to skill acquisition. Specifically we will investigate the relationship of the status of BDNF with cortical excitability changes and learning that occur during a motor training paradigm. We aim to 1) determine cortical excitability changes by using transcranial magnetic stimulation (TMS) before and after training; 2) to determine finger tracking accuracy before and after training; and 3) determine the presence of BDNF polymorphism in each participant. We are testing healthy adults in this study, and eventually would like to apply to persons who have neurologic disorders such as stroke or dystonia. By applying a magnetic field to the outside of the head, electrical currents are produced within the brain that can stimulate brain tissue. Using TMS, the brain can be studied to gain a greater understanding of the mechanisms associated with cortical excitability in healthy and patient populations. There is limited knowledge of what influence genetic biomarkers such as BDNF have on cortical excitability changes within the cortex following learning. Studies have indicated that people without this certain gene are less likely to show changes in brain excitability during TMS and during motor learning than people with this gene

NCT02074696 BDNF Polymorphism, Genetic

We will screen for the Val66met polymorphism.. Inclusion Criteria: - 18-45 years - no past history of psychiatric or neurologic disease. --- Val66met ---

Primary Outcomes

Description: A computer quantified tracking performance measure in each test. This is a calculation of accuracy by using the equation: AI = 100(P-E)/P. Where E is the root mean square (r.m.s.) error between the target line and the response line, and P is the size of the individual's target pattern, calculated as the r.m.s. difference between the sine wave and the midline separating the upper and lower phases of the sine wave. The magnitude of P is determined by the scale of the vertical axis, which is the subject's range of finger motion. Therefore, the AI is normalized to each subject's own range of motion and takes into account any differences between subjects in the excursion of the tracking target. The maximum possible score is 100%. Negative scores occur when the response line is so distant from the target that it falls on the opposite side of the midline.

Measure: Accuracy Index

Time: Day 1: posttest after training

Secondary Outcomes

Description: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.

Measure: Cortical Excitability

Time: Day 1: baseline

Description: Cortical excitability will be measured with transcranial magnetic stimulation (TMS) single and paired pulse stimulation to measure short-interval intracortical inhibition (SICI), cortical silent period (CSP) and motor evoked potential (MEP) amplitude.

Measure: Cortical Excitability

Time: Day 1: posttest

Other Outcomes

Description: BDNF genetic variant screening will be conducted via saliva sample collected at the end of the session on day 1. We will screen for the Val66met polymorphism.

Measure: BDNF genetic status

Time: Day 1

12 Mechanism of tDCS-induced Learning Enhancement - the Role of Serotonin

The aim of this study is to assess whether the application of a selective serotonin reuptake inhibitor (SSRI) enhances and prolongs the learning enhancement achieved by anodal transcranial direct current stimulation (atDCS). For this, young and older healthy subjects will be tested with a well established learning paradigm. Results of this study may help to support the application of atDCS also in patients, e.g. with dementia or mild cognitive impairment.

NCT02092974 Healthy Young and Older Adults Procedure: tDCS Drug: Citalopram Other: sham-tDCS + placebo

To assess predictors of SSRI-enhanced brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF, Val66Met, COMT, Val158Met, KIBRA, rs17070145, 5-Hydroxytryptamine transporter).. Inclusion Criteria: - right handedness - unobtrusive neuropsychological screening - ability to provide written informed consent - no pathological findings in head MRI - age: 18 to 35 years (young adults) or 50-80 years (older adults) - Highly effective contraception (Pearl Index < 1) or reliable abstinence from any heterosexual relationships in women of childbearing potential Exclusion Criteria: - severe internal or psychiatric disease (especially depression or suicidal thoughts) - epilepsy - cognitive impairment (< SD under age adjusted norm in neuropsychological testing) - concurrent taking of serotonin precursors (tryptophan, 5-HTP) or MAO inhibitors - concurrent taking of tramadol or triptans - concurrent taking of pimozide or linezolid - concurrent taking of other drugs prolonging the QT-interval - long-QT-syndrome - hypokalemia or hypomagnesemia - known intolerance of the study medication - claustrophobia or metallic implants, tattoos (MRI exclusion criteria) - pregnancy or lactation - participation in another drug-interventional clinical trial within the last month or during the entire study - probands that are placed in an institution due to official or judicial order - non-agreement to save and transmit pseudonymised study data within the clinical trial Inclusion Criteria: - right handedness - unobtrusive neuropsychological screening - ability to provide written informed consent - no pathological findings in head MRI - age: 18 to 35 years (young adults) or 50-80 years (older adults) - Highly effective contraception (Pearl Index < 1) or reliable abstinence from any heterosexual relationships in women of childbearing potential Exclusion Criteria: - severe internal or psychiatric disease (especially depression or suicidal thoughts) - epilepsy - cognitive impairment (< SD under age adjusted norm in neuropsychological testing) - concurrent taking of serotonin precursors (tryptophan, 5-HTP) or MAO inhibitors - concurrent taking of tramadol or triptans - concurrent taking of pimozide or linezolid - concurrent taking of other drugs prolonging the QT-interval - long-QT-syndrome - hypokalemia or hypomagnesemia - known intolerance of the study medication - claustrophobia or metallic implants, tattoos (MRI exclusion criteria) - pregnancy or lactation - participation in another drug-interventional clinical trial within the last month or during the entire study - probands that are placed in an institution due to official or judicial order - non-agreement to save and transmit pseudonymised study data within the clinical trial Healthy Young and Older Adults null --- Val66Met ---

Primary Outcomes

Description: Recall score immediately after learning phase (=training of visual-spatial abilities) under tDC stimulation + SSRI application compared to learning under tDC stimulation + placebo.

Measure: Recall score after learning under tDC stimulation + SSRI compared to learning under tDC stimulation + placebo.

Time: immediately after end of learning phase (approx. 1 hour)

Secondary Outcomes

Description: Measurement of recall scores on the evening of the same day after the learning phase (+tDCS + SSRI), the morning of the day after and 1 week later in order to assess the prolongation of atDCS induced learning enhancement by the SSRI.

Measure: prolongation of the atDCS induced learning enhancement by SSRI

Time: 1 week

Description: Measurement of recall scores directly after learning phase after application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo.

Measure: Increase of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo

Time: immediately after learning phase (approx. 1 hour)

Description: Measurement of recall scores on the evening of the same day of learning phase, the morning of the day after and 1 week later under application of atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo, in order to assess prolongation of learning enhancement by SSRI.

Measure: prolongation of learning enhancement by atDCS + placebo or sham-tDCS + SSRI vs. sham-tDCS + placebo

Time: 1 week

Description: To assess predictors of SSRI-enhanced brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF, Val66Met, COMT, Val158Met, KIBRA, rs17070145, 5-Hydroxytryptamine transporter).

Measure: genotyping of learning related polymorphisms

Time: once

13 Modulation of Visual-Spatial Learning in Patients With Mild Cognitive Impairment (MCI) by Transcranial Direct Current Stimulation - Proof of Principle and Mechanisms

The aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement in learning and memory in patients with mild cognitive impairment (MCI) and to examine the underlying neuronal mechanism.

NCT02110043 Mild Cognitive Impairment (MCI) Device: tDCS Behavioral: training
MeSH: Cognitive Dysfunction
HPO: Cognitive impairment Mental deterioration

To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria (MCI patients): - right handedness - amnestic and amnestic plus MCI with: 1. subjective memory impairment; 2. objective memory difficulties, at least 1 SD below gender, age and education adjusted standard values; 3. relatively normal performance in other cognitive domains; 4. no constraints in activities of daily livings 5. age: 50-90 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological diseases, e.g. --- Val66Met ---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.

Measure: Performance in LOCATO task (Visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after end of a 3-day period of training in tDCS condition vs sham condition

Secondary Outcomes

Description: long term effects measured by performance in LOCATO task in tDCS condition after end of cognitve training and after 1 month compared to control conditions

Measure: long term effects

Time: after 1 month vs baseline

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training

Measure: functional changes: Connectivity

Time: end of 3-day cognitive training vs baseline

Description: cortical excitability measured by transcranial magnetic stimulation (TMS)

Measure: cortical excitability

Time: at baseline

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of Life

Time: after 1 month vs baseline

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

Description: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: affective state

Time: immediately after the end of 3-day cognitive training, after 1 month vs. baseline

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

14 Modulation of Visual-Spatial Learning in Healthy Older Adults by Transcranial Direct Current Stimulation - Proof of Principle and Mechanisms

The aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement of learning and memory in healthy older adults and to examine the underlying neuronal mechanism.

NCT02110056 Healthy Older Adults Device: tDCS Behavioral: training

To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria (old healthy controls): - right handedness - unobtrusive neuropsychological screening - age: 50-90 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological diseases, e.g. --- Val66Met ---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to an improvement of visual-spatial learning and memory measured by performance in LOCATO task after end of a 3 day training period compared to sham stimulation.

Measure: Performance in LOCATO task (Visual-Spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after the end of a 3 day training period in tDCS condition compared to sham condition

Secondary Outcomes

Description: long term effects measured by performance in LOCATO task after end of training and after 1 month compared to control condition

Measure: long term effects

Time: after 1 month vs baseline

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of 3 day period of training

Measure: functional changes: Connectivity

Time: after end of 3-day period of training vs baseline

Description: measured by transcranial magnetic stimulation (TMS) at baseline

Measure: cortical excitability

Time: at baseline

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of life

Time: after 1 month vs baseline

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

Description: affective state measured at baseline compared to affective state measured after the end of a 3-day cognitve training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: affective state

Time: immediately after the end of 3-day cognitive training, after 1 month vs. baseline

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

15 Modulation of Visual-Spatial Learning in Healthy Young Adults by Transcranial Direct Current Stimulation - Proof of Principle and Mechanisms

The aim of this study is to investigate whether a combination of intensive training of visual-spatial abilities (LOCATO task) with anodal transcranial direct current stimulation (tDCS) leads to an improvement of learning and memory in healthy young adults and to examine the underlying neuronal mechanism.

NCT02110407 Healthy Young Adults Device: tDCS Behavioral: training

To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).. Inclusion Criteria: - right handednesss - unobtrusive neuropsychological screening - age: 18-35 years Exclusion Criteria: - severe internal or psychiatric disease - epilepsy - other severe neurological disease, e.g. --- Val66Met ---

Primary Outcomes

Description: Investigation whether the combination of intensive visual-spatial training (LOCATO task) and tDCS leads to improvement of visual-spatial learning and memory measured by the performance in LOCATO task after end of a 3 day period of training compared to sham stimulation.

Measure: performance in LOCATO task (visual-spatial learning and memory) after a combination of intensive visual-spatial training and tDCS

Time: immediately after end of a 3 day period of training in tDCS condition vs sham condition

Secondary Outcomes

Description: long term effetcs measured by performance in LOCATO task after end of training and after 1 month compared to control conditions

Measure: long term effects

Time: after 1 month vs baseline

Description: Connectivity (measured by resting-state fMRT and correlation analysis) at baseline compared to end of training

Measure: functional changes: Connectivity

Time: after end of 3-day cognitive training vs baseline

Description: cortical excitability measured by transcranial magnetic stimulation (TMS)

Measure: cortical excitability

Time: at baseline

Description: quality of life as measured by standardized questionaire at baseline compared to quality of life measured 1 month after intervention (training and stimulation vs. training and sham-stimualtion)

Measure: Quality of Life

Time: after 1 month vs baseline

Description: memory performance tested at baseline compared to memory performance after the end of a 3-day cognitive training period and after 1 month (posttraining) in training and stimulation vs. training and sham stimulation

Measure: memory

Time: immediately after end of 3-day of cognitive training, after 1 month vs. baseline

Description: To assess predictors of positive reaction to brain stimulation, genotyping of several learning related polymorphisms will be performed (i.e., APOE, BDNF Val66Met, COMT Val158Met).

Measure: genotyping of learning related polymorphisms

Time: once

16 Study of the BDNF- Val66Met Polymorphism in Alcohol-dependent Subjects in Relation to Abstinence After Withdrawal

This study is complementary to the main study "Brain Derived Neurotrophic Factor Serum Levels Evolution During the Six Months After Alcohol Withdrawal " NCT01491347. The purpose of this study is to evaluate the Bdnf gene - Val66Met polymorphism in subjects with alcohol dependence according to their alcohol consumption status 6 months after withdrawal (relapse or abstinence), in relation to the presence of psychiatric co-morbidities.

NCT02146963 Alcohol Dependence
MeSH: Alcoholism

Study of the BDNF- Val66Met Polymorphism in Alcohol-dependent Subjects in Relation to Abstinence After Withdrawal. --- Val66Met ---

Study of the BDNF-Val66Met Polymorphism in Alcohol-dependent Subjects in Relation to Abstinence After Withdrawal This study is complementary to the main study "Brain Derived Neurotrophic Factor Serum Levels Evolution During the Six Months After Alcohol Withdrawal " NCT01491347. --- Val66Met ---

The purpose of this study is to evaluate the Bdnf gene - Val66Met polymorphism in subjects with alcohol dependence according to their alcohol consumption status 6 months after withdrawal (relapse or abstinence), in relation to the presence of psychiatric co-morbidities. --- Val66Met ---

Primary Outcomes

Measure: Frequency of the Bdnf gene Val/Val, Val/Met and Met/Met phenotypes as a function of relapse

Time: at the time of inclusion

Secondary Outcomes

Measure: serum BDNF levels variations between inclusion and 6 months later (or 4 months if the participants does not come for the 4 months-follow-up).

Time: 6 months after alcohol withdrawal

Measure: existence of a psychiatric co-morbidity at the inclusion (major depression, schizophrenia, anxiety disorder)

Time: at the time of inclusion

Measure: presence of a psychiatric co-morbidity at 6 months after withdrawal (major depression, schizophrenia, anxiety disorder)

Time: 6 month after alcohol withdrawal

17 High-intensity Exercise and Fall Prevention Boot Camp for Parkinson's Disease

Several animal and human epidemiologic studies have provided evidence that exercise may be neuroprotective in Parkinson's disease (PD). Exercise may forestall diagnosis and, in the case of those who have already been diagnosed with PD, it may slow the observed neurodegeneration. Unfortunately, because this line of research is in early stages, there is little evidence to indicate what biological mechanisms underlie the neuroprotection that is conferred with exercise. Toward this end, it is possible that an interaction between endogenous antioxidant enzymes, inflammatory processes, and reactive oxygen species may be associated with exercise improvements in PD. One of the most common reasons for premature death in PD is falls. Several meta-analyses have concluded that exercise training programs focused on balance and/or strength training are effective at improving aspects of balance. Taken together, the current body of evidence suggests that exercise may be neuroprotective and balance/strength training may decrease the likelihood of a fall. The combination of these efficacious treatment modalities (exercise and balance/strength training) in a comprehensive treatment approach to improve PD symptoms and balance has been previously reported at relatively mild or moderate exercise intensities. Because recent research has suggested that patients with PD may benefit more from more physically intense programs, we are proposing a more aggressive approach with regard to exercise intensity and frequency in the present trial. The primary purpose of this study is to determine the feasibility and safety of a high intensity exercise approach to PD. A secondary purpose is to determine the trajectory of change in outcomes over the duration of the trial from a high intensity fall prevention program. It is hoped that a signal of efficacy will allow this trial to progress to a comparative effectiveness trial. An important innovative design element is collecting biological assays to better understand the mechanism underlying the anticipated clinical improvements. Aim 1 is to test the feasibility of a high-intensity exercise and fall prevention boot camp (HIBC) in patients with PD by analyzing adherence and whether they achieve minimum Centers for Disease Control exercise standards (150 min/wk moderate level aerobic exercise; strengthening at least two times per week) for the duration of the trial. Aim 2 is to determine if participation in an 8-week HIBC under the direction of a physical therapist is safe for individuals with PD. Secondary Aim 3 is to determine if participation in an 8-week HIBC will produce a signal of efficacy for several physical outcomes: falls per physical activity ratio, balance efficacy, motor activity, fatigue, muscle strength, bone health, cognition/mood, and quality of life. Secondary Aim 4 is to determine if participation in an 8-week HIBC will produce a signal of efficacy for biological outcomes, anti-inflammatory cytokines and anti-oxidant enzymes. An additional exploratory aim will be an analysis of BDNF val66val, val66met, met66met polymorphisms to determine if there is a differential response to exercise. This trial is innovative because it utilizes a high intensity comprehensive exercise treatment approach (aerobic exercise, strengthening, and balance training). To our knowledge, there have been no trials of individuals with PD who have participated in a trial of this intensity in a group "boot camp" setting. Another innovative design element is the use of three novel assessments: biological assays of pro- and anti-inflammatory cytokines, endogenous anti-oxidant enzymes and a novel assessment of falls (falls per physical activity ratio). Participants will be randomly assigned into either an 8-week HIBC group or an 8-week usual care control group (standard, low intensity group therapy class) under the direction of physical therapists. Each group will have 15 participants with a 1:5 patient-to-therapist ratio. The HIBC will be 1.5 hours daily, Monday through Friday. Participants will be required to attend 3 out of the 5 days. The protocol of the HIBC will include the following exercise components: A. 30 minutes of moderate-high intensity aerobic exercise; B. 15 minutes of strengthening the major muscle groups; C. 15 minutes of balance training; and, D. 15 minutes of interspersed rest and stretching. Participants will rotate through these four exercise components. Participants will have one baseline test and assessments at the 2-week, 4 week, 8-week, and 6-month points. Outcomes of the primary aims (Aim 1 and Aim 2) will be frequency counts of participation, adverse events, and compliance with exercise. The outcomes for the secondary aims will include measures of balance and falls, physical capacity, fatigue, exercise/physical activity behavior, and biological assays.

NCT02230267 Parkinson's Disease Other: High intensity exercise and balance training Other: Usual care arm exercise
MeSH: Parkinson Disease

An additional exploratory aim will be an analysis of BDNF val66val, val66met, met66met polymorphisms to determine if there is a differential response to exercise. --- val66met ---

Primary Outcomes

Description: The number of participants that attend and participate in the treatment at least 3 times per week for 8 weeks.

Measure: Frequency feasibility

Time: After completion of the 8 week trial

Description: The number of participants that complete at least 150 minutes per week of moderate intensity exercise (70%+ of their estimated HR maximum). This will be ascertained using heart rate monitors.

Measure: Aerobic feasibility

Time: At the end of the 8 week trial

Description: The number of participants that participate in strengthening exercises that incorporates all the major muscle groups at least two days per week.

Measure: Strength feasibility

Time: At the end of the 8 week trial

Description: Drop-out rate and reason for drop-out will be tracked.

Measure: Compliance

Time: At the end of the 8 week trial

Description: Exercise-related adverse events (e.g., strains/sprains, cardiovascular events).

Measure: Safety

Time: Ongoing throughout the 8 week trial

Description: The Intrinsic Motivation Inventory (IMI) will be used to gather information about motivation.

Measure: Motivation

Time: At 8 weeks

Description: Falls and fall injuries in and out of boot camp will be collected.

Measure: Falls

Time: At the end of the 8 week trial

Secondary Outcomes

Description: Falls will be tracked for 6 months after the boot camp using a falls diary. A member of the research team will call each month to interview participants about their falls. We will assess falls/fall injuries per physical activity ratio during the 6 month period following the trial and time to a fall/fall injury after the trial.

Measure: Falls

Time: up to 6 months

Description: Physical activity will be assessed using the Physical Activity Monitoring System (PAMsys).

Measure: Motor activity

Time: up to 6 months

Description: Fatigue will be assessed using the Parkinson Fatigue Scale (PFS).

Measure: Fatigue

Time: up to 6 months

Description: This will be assessed functionally using the 30 second Sit-To-Stand Test (30STS) for muscle strength.

Measure: Strength

Time: up to 6 months

Description: Cognition will be assessed using the Montreal Cognitive Assessment (MoCA).

Measure: Cognition

Time: up to 6 months

Description: This will be assessed by using a measure of disease-specific quality of life (Parkinson's Disease Questionnaire-39 (PDQ39)).

Measure: Quality of life

Time: up to 6 months

Description: All participants will track their participation in exercise and physical activity using an exercise diary for 6 months following the boot camp. Participants will be called monthly to reinforce completion of the exercise diary.

Measure: Long term behavioral change

Time: up to 6 months

Description: Performance-based balance tasks.

Measure: mini-Balance Evaluation Systems Test (mini-BESTest)

Time: up to 6 months

Description: Activities Specific Balance Confidence Scale (ABC)

Measure: Falls self-efficacy

Time: up to 6 months

Description: Self-report measurement tool: Falls Efficacy Scale (FES)

Measure: Fall Efficacy

Time: Up to 6 months

Description: Self-report of fall catastrophization: Catastrophization about Falls Questionnaire (CAFS)

Measure: Fall catastrophization

Time: Up to 6 months

Description: Self-report measure physical activity: International Physical Activity Questionnaire (IPAQ)

Measure: Physical activity

Time: Up to 6 months

Description: Unified Parkinson's Disease Rating Scale motor subscale (UDPRS III)

Measure: Motor symptoms

Time: Up to 6 months

Description: Self-report scale of avoidance behavior due to a fear of falling: Fear of Falls Avoidance Behavior Questionnaire (FFABQ)

Measure: Fear of falling

Time: Up to 6 months

Description: Endurance will be assessed using the 6 Minute Walk Test (6MWT).

Measure: Endurance

Time: Up to 6 months

Description: Bone health will be measured using bone mineral densiometry (BMD).

Measure: bone health

Time: up to 6 months

Description: Mood will be measured using the Beck Depression Inventory.

Measure: Mood

Time: up to 6 months

Description: Catalase concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: Catalase

Time: Up to 6 months

Description: Cytokine (TNFα, IL-6, IL-10) concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: Cytokines

Time: Up to 6 months

Other Outcomes

Description: Circulating BDNF concentrations from blood will be quantified utilizing enzyme-linked immunosorbent assays.

Measure: BDNF

Time: up to 6 months

18 BDNF as a Potential Biomarker for Cognitive Remediation Therapy in Schizophrenia

The main objective of the study is to analyse the role of a neurotrophic factor (BDNF) as a putative biological marker of the cognitive recovery in schizophrenia following a Cognitive Remediation Therapy (CRT). Additionally, the role as outcome predictors of BDNF serum levels and the Val66met polymorphism and data from functional and structural neuroimaging will be studied.

NCT02341131 Schizophrenia Behavioral: Cognitive Remediation Therapy Behavioral: Psychoeducation
MeSH: Schizophrenia
HPO: Schizophrenia

Additionally, the role as outcome predictors of BDNF serum levels and the Val66met polymorphism and data from functional and structural neuroimaging will be studied. --- Val66met ---

Primary Outcomes

Description: Change Measurements of serum BDNF levels will be carried out by personnel blind to subjects' group assignment. Platelet and serum samples will be diluted with diluent included in the R&D Human BDNF Quantikine Enzym Linked Immunosorbent Assay (ELISA) kit (Yasuhito et al. 1987).

Measure: BDNF (change from baseline serum BDNF levels)

Time: Baseline, 1 month and 4 months

Secondary Outcomes

Description: Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores at time 16 weeks

Measure: Symptoms (Change from baseline in Positive and Negative Syndrome Scale (PANSS) scores)

Time: Baseline and 4 months

19 Does the Brain-derived Neurotrophic Factor Val66Met Gene Polymorphism Predict Inter-individual Variation in Responsiveness Following Lumbar Radiofrequency Denervation? A Single-centre, Prospective, Exploratory Study in Subjects Diagnosed With Zygapophysial Joint Pain

The Investigators have designed this exploratory study in patients suffering from zygapophysial joint mediated pain to investigate if a correlation exists between inter-individual genetic variability (genotype) with treatment response (phenotype). More specifically, the investigators aim to identify any form of correlation between a specific SNP of the BDNF gene (Val66Met) and the effectiveness and/or duration of radiofrequency facet joint neurotomy. The study population is patients suffering from chronic low back pain who have been scheduled for radiofrequency neurotomy following the diagnosis of facet joint mediated pain (using medial branch block test). The investigators will evaluate if a common variant of BDNF gene (Val66Met) can be directly correlated to a significant degree of pain relief following RF treatment, and whether the result of such a procedure can be predicted from a specific genetic profile.

NCT02383524 Chronic Low Back Pain Procedure: Lumbar Radiofrequency Medial Branch Neurolysis
MeSH: Back Pain Low Back Pain
HPO: Back pain Low back pain

Does the Brain-derived Neurotrophic Factor Val66Met Gene Polymorphism Predict Inter-individual Variation in Responsiveness Following Lumbar Radiofrequency Denervation? --- Val66Met ---

More specifically, the investigators aim to identify any form of correlation between a specific SNP of the BDNF gene (Val66Met) and the effectiveness and/or duration of radiofrequency facet joint neurotomy. --- Val66Met ---

The investigators will evaluate if a common variant of BDNF gene (Val66Met) can be directly correlated to a significant degree of pain relief following RF treatment, and whether the result of such a procedure can be predicted from a specific genetic profile. --- Val66Met ---

Primary Outcomes

Description: Number of patients in each group who report 50% reduction in pain on the visual analogue scale 3 months after radiofrequency denervation for lumbar zygapophysial (facet) joint mediated pain

Measure: Responder Rate

Time: 3 months

Secondary Outcomes

Measure: Medication intake, Functional status, Ability to work and Quality of life

Time: 3 months

Other Outcomes

Description: To evaluate whether any specific and/or combination of SNPs observed could be related with the clinical outcomes measured in this study

Measure: Pre-specified Single Nucleotide Polymorphism (SNP) analysis

Time: 3 months

20 Evolving Methods to Combine Cognitive and Physical Training for Individuals With Mild Cognitive Impairment: An Efficacy Study

This study aims to investigate and compare the intervention effects of combining exercise and cognitive training (either sequentially or simultaneously in a dual-task paradigm) in elderly with mild cognitive impairment. The investigators hypothesize that (1) both sequential and dual-task training can induce greater improvements in the outcome measures than single mode of training; (2) the improvement in cognitive functions and other outcomes may differ between the groups.

NCT02512627 Mild Cognitive Impairment Behavioral: Cognitive training Behavioral: Physical exercise
MeSH: Cognitive Dysfunction
HPO: Cognitive impairment Mental deterioration

The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.. BDNF val66met genotype. --- val66met ---

Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.. Inclusion Criteria: 1. able to follow instruction, 2. clinical dementia rating (CDR) = 0.5 or 1, 3. self- or informant-reported memory or cognitive complaint, and 4. able to perform activities of daily living (Barthel Index ≥ 70). --- val66met ---

Primary Outcomes

Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30.

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Stroop test will be used to assess the processing speed, inhibition, set-shifting, and selective attention abilities. The participants will be tested under 2 conditions: congruent and incongruent conditions. In the congruent condition, the color ink of a word is consistent with the written color name; while the color ink differs from the written color name under the incongruent condition.

Measure: Change scores of Stroop test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.

Measure: Change scores of Dual-task test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The TUG test will be used to assess the mobility and dynamic balance ability. The participants will be required to stand up from a chair, walk 3 meters, turn around, then walk back to the chair, and sit down. The time to complete the TUG test has been shown to be a good indicator to detect potential fallers and frail elderly (Podsiadlo & Richardson, 1991). The test-retest reliability of TUG on individuals with cognitive impairment was excellent (Blankevoort, van Heuvelen, & Scherder, 2013).

Measure: Change scores of Timed up and go (TUG) test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Secondary Outcomes

Description: Verbal fluency tests will be used to evaluate the semantic memory of the participants. The participants will be instructed to say as many words as possible from a given category (i.e., fruit or animal) in 1 minute. The validity, reliability, and normative performance of verbal fluency tests have been well-established (Harrison, Buxton, Husain, & Wise, 2000).

Measure: Change scores of the Verbal Fluency Test

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Useful field of view (UFOV) is the visual area over which useful information could be obtained at a quick glance without eye or head movements. This UFOV will be assessed with the BrainHQ program. The UFOV will assess the abilities of visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007).

Measure: Change scores of the Useful Field of View (UFOV)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The 30 second chair stand test (CST) will be assessed to indicate the strength and endurance level of the lower extremities. The participants will be asked to stand up from a standardized chair and then sit down as many times as possible within 30 seconds. The feasibility and reliability of using CST in people with cognitive impairment have been established to be good (Blankevoort et al., 2013).

Measure: Change scores of the 30 second chair stand test (CST)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Chinese version of the International Physical Activity Questionnaires (IPAQ) is an international measure for health-related physical activity. A short form of IPAQ will be used to assess changes in physical activity before and after intervention in this study. The reliability and validity of IPAQ has been established across 12 countries (Craig et al., 2003).

Measure: Change scores of the Chinese version of the International Physical Activity Questionnaires (IPAQ)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Assess activities of daily living

Measure: Change scores of the Barthel Index (BI)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Assess activities of daily living.

Measure: Change scores of the Lawton Instrumental Activities of Daily Living Scale

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Assess activities of daily living.

Measure: Change scores of the Disability Assessment for Dementia (DAD)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Chinese version of QoLAD will be used.

Measure: Change scores of the Quality of Life in Alzheimer's Disease Instrument (QoLAD)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Chinese version of CBI will be used.

Measure: Change scores of the Caregiver Burden Inventory (CBI)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Chinese version of short form GDS will be used.

Measure: Change scores of the Geriatric Depression Scale (GDS)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The CIQ measures items relevant to home integration, social integration, and productive activities.

Measure: Change scores of the Community Integration Questionnaire (CIQ)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The actigraphy will be placed on the waist for a 3-day period immediately before and after the intervention. The participants will wear the actigraphy during all daily activities except for those that involve water (i.e., showering or swimming).

Measure: Change scores of the ActiGraph GX3 accelerometers Change scores of the ActiGraph

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The participant will be seated upright in a chair with back support, the knee will be placed in 90-degree flexion and the evaluator will stabilize the thing to eliminate synergistic movements. Participants will be asked to perform a maximal isometric contraction of knee flexion and extension with both lower extremities. The investigators will record the mean value of 3 attempts.

Measure: Change scores of evaluating isometric knee flexors and extensors muscle strength

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The participant is seated, with the elbow at 90-degree flexion. The investigators will record the mean value of 3 attempts.

Measure: Change scores of using hand dynamometer to measure grip strength of both hand

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The investigators will use the WMS-III subtests, including Faces Recognition (score range 0-48), Verbal Paired Associates (score range 0-32), Word Lists (0-48), and Spatial Span (0-32) to assess the immediate, delayed, and working memory tests. Higher scores indicated better performance for each subtest. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general memory function.

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The WAIS-III includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed. The subtests that the investigators will use are the Digit Symbol-Coding (scores range 0-133) and Matrix Reasoning tests (0-26). The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.

Measure: BDNF val66met genotype

Time: baseline

21 Synergistic Effects of Aerobic Exercise and Cognitive Training on Cognition, Physiological Markers, Daily Function and Quality of Life in Stroke Patients With Cognitive Decline

The purpose of this study is to determine the treatment effects of sequential combination of aerobic exercise and cognitive training on cognitive function, physiological markers, daily function, physical function, social participation and quality of life in stroke patients with cognitive decline. The investigators hypothesized that: (1) sequential training protocol can improve outcome measures compared to single mode of training; (2) these treatment effects will retain at 6-month follow-up.

NCT02550990 Stroke Patients With Cognitive Decline Behavioral: Cognitive training Behavioral: Aerobic exercise training Behavioral: Sequential combination of aerobic exercise and cognitive training
MeSH: Stroke Cognitive Dysfunction
HPO: Cognitive impairment Mental deterioration Stroke

Genotyping of the BDNF val66met polymorphism. --- val66met ---

Primary Outcomes

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Stroop Color-Word test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The dual-task tests will be assessed to determine the ability for an individual to perform 2 tasks simultaneously. The investigators will assess the dual-task performance during walking and performing box and block test. The results of the dual-task tests will provide information regarding to whether the 2 tasks compete for the same class of neural resources or one of the tasks can be carried out automatically.

Measure: Change scores of Dual-task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Secondary Outcomes

Measure: Change scores of serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Change scores of Antioxidative marker

Time: Baseline, posttest (an expected average of 3 months)

Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.

Measure: Change scores of Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Change scores of Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Caregiver Burden (CB) scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of EuroQol (EQ)-5D questionnaire

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Timed up and go test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Six-minute walk test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Mobility level

Time: Baseline, posttest (an expected average of 3 months)

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Fugl-Meyer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of muscle strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Measure: Genotyping of the BDNF val66met polymorphism

Time: Between baseline and posttest (an expected average of 3 months)

22 Secondary Prevention of Depression Applying an Experimental Attentional Bias Modification Procedure

Depression (Major Depressive Disorder; MDD) has been dubbed "the common cold among the mental illnesses" and it is also a highly recurrent disorder. Secondary prevention has been identified as a key goal in the long-term management of depression. High recurrence rate suggests that there are specific vulnerability factors that increase people's risk for developing repeated episodes of the disorder. Preventive strategies should identify and ameliorate these factors to reduce the individual's risk of subsequent episodes. Biased attention for emotional stimuli is central to the cognitive model where increased sensitivity to negative cues is believed to fuel the negative thoughts and feelings in depression and play a key role in maintaining the illness. Selective biases in attention can be modified by a simple computerized technique; The Attention Bias Modification Task (ABM). This project aims to investigate whether ABM can reduce surrogate and clinical markers of relapse in a large group highly vulnerable to depressive episodes. The effects of ABM, immediately after the two weeks intervention, on three key risk factors for depression will be studied: Residual symptoms, cortisol awakening response and emotion regulation strategies. The participants will be followed up after 1 month, 6 months and 12 months. The hypothesis that ABM will reduce subsequent episodes of low mood over the following 12 months in this group in a manner predicted by early changes in these risk factors will be investigated. It will also be tested if such effects in the lab may be dependent on candidate genes which affect serotonin reuptake and which have been implicated in malleability and emotional learning. Effects on underlying neural correlates of emotion regulation will be studied in an fMRI experiment in a sub-sample and which will also be stratified by serotonin transporter genotype (see also NCT02931487). The predictive value of meta cognitions related to rumination and the possible mediating effects of automatic thoughts and perceived stress will also be investigated in a sub group (see also NCT02648165). The characterization of the cognitive, genetic and neural mechanisms underlying the ABM effect will have key implications for future treatment development and combination with other treatment modalities like pharmacotherapy.

NCT02658682 Major Depression Behavioral: Attention Bias Modification Behavioral: Sham Attention Bias Modification
MeSH: Depression Depressive Disorder
HPO: Depressivity

Brain Derived Neurotrophic Factor (BDNF) val66met polymorphic variation linked to Brian Derived Neurotrophic Factor (BDNF) variation will moderate the effect of ABM on residual symptoms compared to neutral ABM placebo condition. --- val66met ---

Primary Outcomes

Description: Beck Depression Inventory

Measure: Change in residual symptoms of depression. Self report.

Time: At baseline and immediately after ABM intervention (during first week after ABM).

Description: Hamilton Depression Rating Scale

Measure: Change in residual symptoms of depression. Clinician rating

Time: At baseline and immediately after ABM intervention (during first week after ABM).

Secondary Outcomes

Description: Measured by the MINI structured interview

Measure: Recurrence of major depressive episodes

Time: Will be measured 12 month after baseline

Description: Emotion Regulation Questionnaire (ERQ).

Measure: Changes in Emotion Regulation

Time: At baseline.

Description: The Rumination Response Scale

Measure: Changes in Rumination

Time: At baseline and 12 months after intervention

Description: Cortisol samples from saliva measured by diural variation (6 samples).

Measure: Changes in cortisol response.

Time: At baseline, immediately after ABM intervention and one month after intervention.

Description: Beck Anxiety Inventory

Measure: Changes in symptoms of anxiety

Time: At baseline, immediately after ABM intervention (during first week after ABM intervention), 1 month after intervention, 6 months after intervention and 12 months after intervention

Other Outcomes

Description: Automatic Thought Questionnaire (ATQ)

Measure: Automatic thoughts

Time: At baseline, immediately after ABM intervention (average one day), 1 month after intervention, 6 months after intervention and 12 months after intervention

Description: Perceived Stress Scale (PSS).

Measure: Changes in perceived stress

Time: At baseline, immediately after ABM intervention (average one day), , 1 month after intervention, 6 months after intervention and 12 months after intervention

Description: Positive and Negative Beliefs about Rumination scale (PBRS and NBRS)

Measure: Meta cognitions

Time: At baseline and 12 months after intervention

Measure: 5-HTTLPR+A>G polymorphic variation divided by the triallelic functional "high expressive" versus "low expressive" genotype will moderat the effect of ABM on residual symptoms compared to neutral ABM placebo condition

Time: Immediately after ABM intervention.

Measure: Brain Derived Neurotrophic Factor (BDNF) val66met polymorphic variation linked to Brian Derived Neurotrophic Factor (BDNF) variation will moderate the effect of ABM on residual symptoms compared to neutral ABM placebo condition

Time: Immediately after ABM intervention.

Measure: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on residual symptoms compared to neutral placebo condition

Time: Immediately after ABM intervention.

Description: Beck Depression Inventory

Measure: Change in residual symptoms of depression. Self report

Time: One month after intervention, 6 months after intervention and 12 months after intervention

Description: Hamilton Depression Rating Scale

Measure: Change in residual symptoms of depression. Clinical rating

Time: One month after intervention, 6 month after intervention and 12 month after intervention

Measure: Primary outcome measures will be modified by the degree of attentional change during the ABM intervention.

Time: Immediately after the ABM intervention

Measure: Primary outcome measures will be modified by executive functioning

Time: At baseline

23 The Development of Skin Adhesive Patches for the Monitoring and Prediction of Mental Disorders

development of skin adhesive patches for the monitoring and prediction of mental disorders

NCT02690324 Major Depressive Disorder, Anxiety Disorder Behavioral: cognitive stress (serial 7)
MeSH: Depressive Disorder Depressive Disorder, Major Anxiety Disorders
HPO: Depressivity

Brain-derived neurotrophic factor(BDNF) genotyping: Val66Met. --- Val66Met ---

Primary Outcomes

Description: changes of skin conductane level(SCL) and skin conductance response(SCR)

Measure: Electrodermal activity(EDA)

Time: baseline, 0.5, 1,2,3 months

Description: changes of SDNN, RMSSD and LF/HF ratio

Measure: Heart rate variability

Time: baseline, 0.5, 1,2,3 months

Secondary Outcomes

Measure: Brain-derived neurotrophic factor(BDNF) genotyping: Val66Met

Time: baseline, 0.5, 1,2,3 months

Description: IL-1α, IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12(p70), IFN-γ, TNF-α

Measure: Cytokines

Time: baseline, 0.5, 1,2,3 months

Measure: Leptin

Time: baseline, 0.5, 1,2,3 months

Measure: Adiponectin

Time: baseline, 0.5, 1,2,3 months

Measure: Epinephrine

Time: baseline, 0.5, 1,2,3 months

Measure: Norepinephrine

Time: baseline, 0.5, 1,2,3 months

Measure: C reactive protein

Time: baseline, 0.5, 1,2,3 months

Description: serum, plasma, platelet BDNF

Measure: BDNF

Time: baseline, 0.5, 1,2,3 months

Description: structured interview assessing for DSM-IV Axis I disorders with strong reliability and validity in relation to the Structured Clinical Interview for DSM-IV (SCID-IV)

Measure: MINI plus

Time: Baseline

Description: assess current and past Axis I diagnoses

Measure: MINI Suicidality Module

Time: baseline, 0.5, 1,2,3 months

Description: changes of HAMD-17 total socres

Measure: Hamilton Depression Rating Scale-17(HAMD-17)

Time: baseline, 0.5, 1,2,3 months

Description: changes of HAMA total scores

Measure: Hamilton Anxiety Rating Scale(HAMA)

Time: baseline, 0.5, 1,2,3 months

Description: ASI-3 to measure the three most supported AS domains: social (i.e., fear of exhibiting symptoms in public that may elicit embarrassment), cognitive (i.e., fear of losing cognitive control or experiencing concentration difficulties), and physical (i.e., fear that physical sensations are a sign of an immediate physical problem).

Measure: Anxiety Sensitivity Index(ASI)

Time: baseline, 0.5, 1,2,3 months

Description: The APPQ (Rapee et al., 1995) is a 27-item instrument that is designed to measure interoceptive, agoraphobic, and social situational fear. Subjects respond to each item on a 9-point Likert scale from 0 to 8, according to how much fear they think they would experience in a given situation so that total scores range from 0 to 216.

Measure: APPQ(Albany Panic and Phobia Questionnaire)

Time: baseline, 0.5, 1,2,3 months

Description: 16-item questionnaire that aims to measure the trait of worry, using Likert rating from 1 (not at all typical of me) to 5 (very typical of me)

Measure: PSWQ(Penn state worry questionnaire)

Time: baseline, 0.5, 1,2,3 months

Description: emotional, somatic, cognitive, and behavioral stress responses.

Measure: SRI(Stress response Inventory)

Time: baseline, 0.5, 1,2,3 months

Description: The Perceived Stress Scale (PSS) is the most widely used psychological instrument for measuring the perception of stress. It is a measure of the degree to which situations in one's life are appraised as stressful.

Measure: Perceived Stress Scale(PSS)

Time: baseline, 0.5, 1,2,3 months

Description: The Barratt Impulsiveness Scale (BIS) is a widely used measure of impulsiveness. It includes 30 items that are scored to yield six first-order factors (attention, motor, self-control, cognitive complexity, perseverance, and cognitive instability impulsiveness) and three second-order factors (attentional, motor, and non-planning impulsiveness).The BIS-11 is a 30-item self-report questionnaire, that is scored to yield a total score, three second-order factors, and six first-order factors.

Measure: Barratt Impulsivity Scale

Time: baseline, 0.5, 1,2,3 months

Description: The items assess panic frequency, distress during panic, panic-focused anticipatory anxiety, phobic avoidance of situations, phobic avoidance of physical sensations, impairment in work functioning, and impairment in social functioning. The overall assessment is made by a total score, which is calculated by summing the scores for all seven items. The total scores range from 0 to 28.

Measure: Panic disorder severity scale(PDSS)

Time: baseline, 0.5, 1,2,3 months

24 Restoring Emotion Regulation Networks in Depression Vulnerability: An Experimental Study Applying an Attention Bias Modification Procedure

Selective biases in attention can be modified by a simple computerized technique: The Attention Bias Modification Task (ABM) pioneered by MacLeod et al. Cognitive biases may be one reason depression recurs, and altering these biases should reduce risk of recurrence. Recently, evidence has supported this hypothesis . The mechanisms by which ABM works are not well understood. More research is needed to explore how altering an implicit attentional bias can lead to changes in subjective mood. One possible explanation is that positive attentional biases are an important component of explicit methods of emotion regulation. The ability to effectively regulate one's emotions is a fundamental component of mental health and this ability is impaired in depression. It has also been shown that recovered depressed people spontaneously show a more dysfunctional pattern of emotion regulation as compared to never depressed controls. Supporting this, growing evidence implicates dysregulation of a medial/orbitofrontal circuit in mood disorders. This circuit includes the orbitofrontal cortex and anterior cingulate cortex, the ventral striatum, the ventral pallidum and medial thalamus. Components of this circuit are reciprocally connected with the amygdala, which is implicated in emotional processing in the healthy brain and dysregulated in depression. Negative emotion processing biases depend on both enhanced "bottom-up" responses to emotionally salient stimuli and reduces "top-down" cognitive control mechanisms, required to suppress responses to emotionally salient but task irrelevant information. Cognitive reappraisal and distancing are common strategies to down- or upregulate emotional responses. Reappraisal is an emotion regulation strategy that involves reinterpretation and changing the way one thinks about an event or stimulus with the goal of changing its affective impact. Distancing is a type of reappraisal that involves creating mental space between oneself and the emotional event in order to see things from a different, less self-focused perspective. It has been shown that distancing is a strategy that people can improve at over time compared to reinterpretation. The neural systems which support the explicit regulation of emotion have previously been characterized and include both lateral- and prefrontal cortex. This frontal activity is predicted to downregulate limbic circuitry involving the amygdala during passive viewing of emotional salient stimuli.

NCT02931487 Major Depression Behavioral: Attentional Bias Modification Behavioral: Sham Comparator
MeSH: Depression Depressive Disorder
HPO: Depressivity

Brain Derived Neurotropic Factor (BDNF) val66met polymorphic variation linked to Brain Derived Neurotropic Factor (BDNF) variation will differentiate between ABMT and neutral AMB placebo as measured by fMRI whole brain BOLD responses.. Serotonergic cumulative genetic score and fMRI. --- val66met ---

Primary Outcomes

Description: Stronger fMRI BOLD response in prefrontal cortical regions in ABMT compared to neutral AMB placebo condition.

Measure: BOLD response in prefrontal cortical regions

Time: Two weeks after after ABM-training

Secondary Outcomes

Description: Lower ABM fMRI BOLD response within the amygdala in ABMT compared to neutral ABM placebo condition.

Measure: BOLD response within the amygdala

Time: Two weeks after ABM-training

Description: Increased neural integrity as measured by fractional anisotropy values in the uncinate fasciculi (UF) in the active AMBT compared to neutral ABM placebo condition.

Measure: DTI

Time: Two weeks after ABM-training

Description: Increased integrity within the attentional networks at rest as measured by independent component analysis (ICA) in ABMT compared to neutral ABM training.

Measure: RSFC

Time: Two weeks after ABM-training

Description: The low expressive variant will be associated with more frontal BOLD activation and lower amygdala activation after ABMT

Measure: 5-HTTLPR + A>G polymorphic variation divided by the triallelic functional "high expressive" versus "low expressive" genotype will moderate the impact from ABMT as measured by whole brain BOLD responses.

Time: Two weeks after ABM-training

Description: Brain Derived Neurotropic Factor (BDNF) val66met polymorphic variation linked to Brain Derived Neurotropic Factor (BDNF) variation will differentiate between ABMT and neutral AMB placebo as measured by fMRI whole brain BOLD responses.

Measure: BDNF

Time: Two week after ABM-training

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on fMRI BOLD signal compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and fMRI

Time: Two weeks after ABM-training

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on structural MRI as measured by total grey matter volume compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and morphompetry

Time: Two weeks after ABM-training

Description: A serotonergic cumulative Genetic score, including (5-HHTLPR, HTR1A 8rs6295) and HTR 2A (rs 6311) polymorphisms will moderate the effects of ABM on DTI MRI as measured by fractional anisotropy compared to a neutral placebo condition.

Measure: Serotonergic cumulative genetic score and fMRI and DTI

Time: Two weeks after ABM-training

25 The Effects and Mechanism of the Sequential Combination of Exercise and Cognitive Training on Cognitive Function in Stroke Patients With Cognitive Decline: A Randomized Controlled Trial

The purpose of this study is to determine the treatment effects of sequential combination of aerobic exercise and cognitive training on cognitive function, physiological markers, daily function, physical function, social participation and quality of life in stroke patients with cognitive decline.

NCT03045991 Stroke Patients With Cognitive Decline Behavioral: aerobic exercise training Behavioral: control training Behavioral: cognitive training
MeSH: Stroke Cognitive Dysfunction
HPO: Cognitive impairment Mental deterioration Stroke

The Chinese version of short form GDS will be used.. Genotyping of the BDNF val66met polymorphism. --- val66met ---

Primary Outcomes

Description: The MoCA will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30

Measure: Change scores of Montreal Cognitive Assessment (MoCA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The WMS-III is a standardized and reliable neuropsychological examination tool designed to evaluate visuospatial and memory functions

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The WAIS-III is developed to measure an individual's intelligence level. It includes tests that evaluate cognitive functions in verbal comprehension, working memory, perceptual organization, and processing speed

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The UFOV assessment is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention.

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Stroop Color-Word assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions.

Measure: Change scores of Stroop Color-Word test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The dual-task test evaluates the ability to shift attention between one task and another. Participants will perform the box and block test (BBT) while doing secondary cognitive tasks while sitting. Participants will perform BBT by affected and less affected hand.

Measure: Change scores of Dual-task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Secondary Outcomes

Description: Up-regulation of neurotrophic and vascular growth factors

Measure: Change scores of serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

Description: Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Change scores of Antioxidative marker

Time: Baseline, posttest (an expected average of 3 months)

Description: HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise

Measure: Change scores of Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

Description: The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Change scores of Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities.

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Lawton IADL scale assesses independent living skills, such as shopping or managing finances.

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The SIS 3.0 will be used to evaluate health-related quality of life for patients with stroke. The SIS assesses eight domains (strength, hand function, ADL/IADL, mobility, communication, emotion, memory and thinking, and participation/role function) with 59 test items.

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: CB scale evaluates the burden of the primary caregiver of the participants. Lessening the burden of caregivers after the intervention may significantly improve the quality of life for patients with stroke and their family.

Measure: Change scores of Caregiver Burden (CB) scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression.

Measure: Change scores of EuroQol (EQ)-5D questionnaire

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down.

Measure: Change scores of Timed up and go test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test.

Measure: Change scores of Six-minute walk test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor.

Measure: Change scores of Mobility level

Time: Baseline, posttest (an expected average of 3 months)

Description: The IPAQ is an international measure of health-related physical activity.

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The UE-FMA subscale will be used to assess the sensorimotor impairment level of UE in patients after stroke. The UE-FMA contains 33 movements with a score range from 0 to 66. A higher UE-FMA score indicates less impairment of the paretic limb. The validity and reliability of FMA is good to excellent.

Measure: Change scores of Fugl-Meyer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The RMI evaluates the participant's bed mobility, postural transfers and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15.

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor. We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of muscle strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The CIQ measures items relevant to home integration, social integration, and productive activities.

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Chinese version of short form GDS will be used.

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Up-regulation of neurotrophic and vascular growth factors

Measure: Genotyping of the BDNF val66met polymorphism

Time: Once during the intervention(an expected average of 3 months)

Description: In addition to MAL, the ActiGraph GX3 accelerometers (ActiGraph, Shalimar, FL, USA) will be used to quantitatively assess the amount of arm use in the participants' home settings.The actigraphy will be placed on bilateral wrist for 3 consecutive days before and after the 1-month intervention. The participants will carry the actigraphy all day except for activities that involve water, such as swimming or bathing. Using the actigraphy, investigators will be able to record and calculate the number of hand movements per minute, and the data will be analyzed with the MAHUFFE software (http://www.mrc-epid.cam.ac.uk/). The actigraphy has often been used to evaluate arm use in patients with stroke.

Measure: Change scores of Actigraphy

Time: Baseline, posttest (an expected average of 3 months)

Description: The Mini-Mental State Examination (MMSE) is the most commonly administered psychometric screening assessment of cognitive functioning. The MMSE is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. The total score of MMSE ranged from 0 to 30. Higher values represent a better cognitive functioning.

Measure: Change scores of Mini-Mental State Exam (MMSE)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The MRC is an ordinal scale that assesses muscle strength. The scoring for each muscle ranges from 0 to 5, with a higher score indicates stronger muscle. The reliability of MRC for all muscle groups was good to excellent in patients with stroke.

Measure: Change scores of Medical Research Council scale (MRC)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The National Institutes of Health Stroke Scale, or NIH Stroke Scale (NIHSS) is a tool used by healthcare providers to objectively quantify the impairment caused by a stroke. The NIHSS is composed of 11 items, each of which scores a specific ability between a 0 and 4. For each item, a score of 0 typically indicates normal function in that specific ability, while a higher score is indicative of some level of impairment. The individual scores from each item are summed in order to calculate a patient's total NIHSS score. The maximum possible score is 42, with the minimum score being a 0.

Measure: Change scores of National Institutes of Health Stroke Scale

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

26 Improving Learning and School Functioning in Latino Children With Cancer

This randomized clinical trial studies how well a high-intensity intervention parenting program works in improving learning and school functioning in Latino children with acute leukemia or lymphoblastic lymphoma. A high-intensity intervention program may help doctors to see whether training parents or caregivers in specific parenting skills and "pro-learning" behaviors will result in better learning and school outcomes for Latino children with acute leukemia or lymphoblastic lymphoma. It is not yet known if a high-intensity intervention program is more beneficial than a standard of care lower intensity parenting intervention.

NCT03178617 Caregiver Childhood Acute Lymphoblastic Leukemia Childhood Acute Myeloid Leukemia Childhood Lymphoblastic Lymphoma Acute Leukemia Parent Other: Educational Intervention Other: Educational Intervention Other: Quality-of-Life Assessment Other: Questionnaire Administration
MeSH: Lymphoma Leukemia Precursor Cell Lymphoblastic Leukemia-Lymphoma Lymphoma, Non-Hodgkin
HPO: Leukemia Lymphoma Non-Hodgkin lymphoma

Obtain preliminary data on the relationships between family stress and the Val66Met polymorphism of brain-derived neurotrophic factor (BDNF) with neurocognitive and health-related quality of life (HRQOL) outcomes in Latino children treated with CNS-directed therapies for cancer. --- Val66Met ---

Primary Outcomes

Description: Measured by the parent-reported Pediatric Quality of Life Inventory school domain.

Measure: Change in child's health-related quality of life school functioning

Time: Baseline up to 12 months

Description: Measured by the Efficacy scale from the Parent Knowledge, Beliefs and Behaviors Questionnaire-3rd Revision (PBQ-R3).

Measure: Change in parental efficacy

Time: Baseline up to 12 months

Measure: Children's neurocognitive functioning as measured by performance scores on Conner's Computerized Test

Time: Up to 12 months

Secondary Outcomes

Description: Measured by WIAT: reading and math scores and classroom grades from school report cards.

Measure: Objective academic performance (Child)

Time: Up to 12 months

Description: Measured by the Conners Parent Report Attention subscale.

Measure: Attention performance (Child)

Time: Up to 12 months

Description: Measured by PBQ-R3 Behaviors Scale.

Measure: Frequency of pro-learning behaviors (Parent)

Time: Up to 12 months

Description: Measured by the Parents' weekly time spent with child in pro-learning behaviors and activities.

Measure: Frequency of pro-learning behaviors (Parent)

Time: Up to 12 months

Description: Measured by PBQ-R3 Knowledge scale.

Measure: Knowledge of pro-learning parenting (Parent)

Time: Up to 12 months

Measure: Children's scores on other neurocognitive tests as assessed by learning, memory, and processing speed

Time: Up to 12 months

Measure: Parental reports of their children's HRQOL as measured by the PedsQL parent proxy questionnaire

Time: Up to 12 months

27 Loss of Depotentiation in Focal Dystonia

Background Focal dystonia is a brain disorder. It affects a muscle or muscles in a specific part of the body. Researchers think it may be related to excessive training or practice. They want to know more about how much training might trigger focal dystonia. Objectives: To study why people develop focal dystonia. To study how brain plasticity changes with focal dystonia. Eligibility: People at least 18 years of age with focal dystonia. Healthy volunteers the same age are also needed. Design: Participants will be screened with a physical exam and questions. They may have blood and urine tests. Participants will have up to 3 testing visits. Participants will have small electrodes stuck on the skin on the hands or arms. Muscle activity will be recorded. Participants will have transcranial magnetic stimulation (TMS). A wire coil will be placed onto the scalp. A brief electrical current will pass through the coil. The current will create a magnetic field that affects brain activity. Participants may be asked to tense certain muscles or do simple actions during TMS. A nerve at the wrist will get weak electrical stimulation. The stimulation may be paired with TMS for very short times. Participants will receive repeated magnetic pulses. Participants will receive a total of 150 pulses during a 10-second period. An entire testing visit will last about 3 hours. ...

NCT03206112 Focal Dystonia Healthy Volunteers Other: PAS25 Other: PAS10 Other: PAS25-cTBS150
MeSH: Dystonia Dystonic Disorders
HPO: Dystonia Focal dystonia Limb dystonia Paroxysmal dystonia Writer's cramp

The Val66Met single nucleotide polymorphism is related to abnormal cortical plasticity. --- Val66Met ---

Primary Outcomes

Description: compare MEP amplitude in patients with that in healthy volunteers to identify whether depotentiation is weaker in focal dystonia

Measure: MEP amplitude immediately after the PAS25-cTBS150 (depotentiation) protocol

Time: throughout

Secondary Outcomes

Description: MEP amplitudes at other time points after the PAS25-cTBS150 procedure

Measure: MEP amplitudes

Time: throughout

28 The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise

The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise. Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. In recent years, a growing number of studies have evaluated the association between these polymorphisms and personality traits related to anxiety and depression. Objectives: To determine the frequencies of 5-HTTLPR and BDNF polymorphisms in a college students population; To determine the influence of 5-HTTLPR and BDNF polymorphisms on mood states and anxiety after acute physical exercise. Material and Methods: Four hundred (400) College students will be assessed. In the first phase of the study, the following procedures will be performed: Screening, Aerobic Fitness Assessment (Step Test), Questionnaires (PAR-Q, Habitual Physical Activity Level, Beck Anxiety and Depression Scale, State-Trait Anxiety, and Perceived Stress Scale), blood sample collection and genotyping. In the second phase of the study, two (2) groups with or without polymorphisms will be selected (for each gene). These groups will be submitted to four conditions (three experimental conditions and one control condition), carried out randomly and separated by an interval of 1 week. In the experimental Conditions the volunteers will perform treadmill exercises sessions (30 minutes) in three different intensities (light, moderate and vigorous) and will respond to the Borg Scale at 10, 20 e 30 minutes. In the control condition the volunteers will be instructed to remain seated (quiet rest), relaxed and silent for 30 minutes. In both conditions, the volunteers will complete the Profile of Mood States (POMS) and State-Anxiety (STAY), 05 (five) minutes before and, 5 (five) and 20 (twenty) minutes following the interventions.

NCT03556176 Polymorphisms Exercise Mood Behavioral: Exercise Behavioral: Quiet rest
MeSH: Anxiety Disorders

Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. --- Val66Met ---

PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).. Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A). --- Val66Met ---

The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. --- Val66Met ---

From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.. Inclusion criteria: - 18-30 years of age; - able to perform physical activities; Non-inclusion criteria: - history of cardiovascular or respiratory diseases; - smoking; - use of psychiatric drugs; - psychotherapy treatment in the last six months. --- Val66Met ---

Primary Outcomes

Description: The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor.

Measure: Response of mood states after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

Description: Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms.

Measure: Response of anxiety after interventions

Time: Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest

Secondary Outcomes

Description: The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study.

Measure: Evaluation safety or possible risk of exercising

Time: baseline

Description: Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes.

Measure: Habitual Physical Activity Level

Time: Baseline

Description: Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings. In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.

Measure: Evaluation of depression and anxiety symptoms

Time: Baseline

Description: McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective

Measure: Estimation the aerobic capacity

Time: Baseline

Description: The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme. The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).

Measure: Detection of the polymorphism in the SLC6A4

Time: Baseline

Description: The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs). From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.

Measure: Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A)

Time: Baseline

29 Efficacy of Transcranial Direct Current Stimulation for Severe Refractory Primary Dysmenorrhea: Translational and Genetic Neuroimaging Studies

Primary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. We have previously reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, we reason that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of functional connectivity (FC) of pain matrix after tDCS intervention. We will recruit 30 severe PDMs and randomly allocate them to either real or sham group in a triple-blind manner. rs-fMRI for functional connectivity analysis will be performed before and after the tDCS intervention. The imaging data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for severe PDM. The result can promise a new possibility for clinical application.

NCT03594916 Primary Dysmenorrhea Device: Active tDCS Device: Sham tDCS
MeSH: Dysmenorrhea
HPO: Dysmenorrhea

To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen. --- Val66Met ---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

Description: Resting-state functional magnetic resonance imaging (rs-fMRI) is a well established method of functional magnetic resonance imaging (fMRI) that is used to evaluate regional interactions in the brain that occur in a resting (task-negative) state, when a subject is not performing an explicit task. Functional connectivity is the connectivity between brain regions that share functional properties, it can be defined as the correlation between spatially remote neurophysiological events, expressed as the neural networks of brain.

Measure: Functional connectivity of rs-fMRI Imaging

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

30 Neuromodulation Effect of Transcranial Direct Current Stimulation in Severe Refractory Primary Dysmenorrhea: BDNF and MEG Study

Primary Dysmenorrhea (PDM), defined as menstrual pain without discernable organic causes, is inexorably common in adolescent women, about 40-90% of women may suffer from it, and 20% of them can be severe in the context of being refractory to medication, daily function impairment, and having pain of severe degree. Novel therapeutic method is in need for pain alleviation for this particular phenotype. It has been reported that PDM females may engage motor-cortex based descending pain modulation system in our resting-state functional Magnetic Resonance Imaging (rs-fMRI) and thermal pain-activation fMRI studies. Based on the reported analgesic efficacy of transcranial Direct Current Stimulation (tDCS) on the motor cortex for various experimental painful conditions and clinical pain disorders, it is plausible that tDCS can be effective for the severe and medication-refractory PDM patients. This study aim to investigate the analgesic efficacy of tDCS in severe PDMs and to elucidate the dynamic brain neuroplasticity in the context of experimental pain after tDCS intervention. Thirty severe PDMs will be recruited and randomly allocated to either real or sham group in a triple-blind manner. Experimental pain electrical stimulation will be performed before and after the tDCS intervention. The experimental pain-evoked magnetoencephamographic (MEG) data will be correlated with behavioral and psychological measurements. This is the first study in the literature investigating the tDCS efficacy for acute pain in severe PDM. The result can promise a new possibility for clinical application.

NCT03608215 Primary Dysmenorrhea Device: Active tDCS Device: Sham tDCS
MeSH: Dysmenorrhea
HPO: Dysmenorrhea

To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen. --- Val66Met ---

Primary Outcomes

Description: pain scale; from 0 to 10; score 0: no pain, score 10: unbearable pain

Measure: Visual Analog Scale (VAS)

Time: change from baseline (1st menstrual phase, before tDCS) at one month (2nd menstrual phase, with tDCS), change from baseline (1st menstrual phase, before tDCS) at two months (3rd menstrual phase)

Description: Somatosensory evoked magnetic fields (SEFs) is a well established magnetoencephalographic (MEG) cortical response evoked by electric stimulation. SEFs to experimental pain stimulation using electrical stimulator applied on the skin over the trajectory of median nerve will be used to evaluate pain-evoked cortical response.

Measure: Somatosensory evoked magnetic fields to experimental pain

Time: change from baseline (before tDCS, before 2nd menstrual phase) at one week (after tDCS completion), change from baseline (before tDCS, before 2nd menstrual phase) at four weeks (before the 3rd menstrual phase)

Secondary Outcomes

Description: To assess the threshold of thermal sensation (cold, cold-pain, heat, heat-pain; from 0 to 50 centigrade temperature), according to the established protocol of an ascending limit approach for heat pain and a descending limit approach for cold pain.

Measure: Quantitative sensory testing (QST)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess anxious symptoms; from 20 to 80; score 20: not anxious, score 80: extremely anxious

Measure: Spielberger State-Trait Anxiety Inventory (STAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess anxious symptoms; from 0 to 63; score 0: not anxious, score 63: extremely anxious

Measure: Beck Anxiety Inventory (BAI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess depressive symptoms; from 0 to 63; score 0: not depressed, score 63: extremely depressed

Measure: Beck Depression Inventory (BDI)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess pain-maladaptive psychological status; from 0 to 52; score 0: not pain Catastrophizing , score 52: extremely pain Catastrophizing

Measure: Pain Catastrophizing Scale (PCS)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess pain status; from 0 to 78; score 0: not painful, score 78: extremely painful

Measure: Long-form McGill Pain Questionnaire (MPQ)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess quality of life; he SF-36 consists of eight scaled scores, which are the weighted sums of the questions in their section. Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. From 0 to 100; score 0: equivalent to maximum disability, score 100: no disability.

Measure: Short-Form Health Survey (SF-36)

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at five weeks (after the 3rd menstrual phase)

Description: To assess testosterone, progesterone, estrogen

Measure: Blood Hormones Measurement

Time: change from baseline (before tDCS) at one week (after tDCS completion), change from baseline (before tDCS) at four weeks (before the 3rd menstrual phase)

Description: To genotype the single nucleotide polymorphism genotyping (i.e., BDNF Val66Met polymorphism (rs6265), COMT Val158Met polymorphism (rs4680), OPRM1 (rs1799971), 5HTR2A (rs6313), SLC6A4 (rs25531)) from blood specimen

Measure: Genotyping

Time: baseline

Description: To assure blinding efficacy; Patients do self-assessment about whether they receive real tDCS or sham tDCS. Assessment questionnaire:1 or 0. 1: real tDCS; 0: sham tDCS.

Measure: Efficacy of tDCS blinding

Time: At 1 months after tDCS intervention

31 Augmentation of Working Memory Training With Transcranial Direct Current Stimulation (tDCS) in Patients With Schizophrenia

Cognitive impairment is a core symptom of schizophrenia and is in a large part responsible for the poor psychosocial outcome of the disorder. The use of non-invasive brain stimulation techniques as a therapeutic option is just commencing for neuropsychiatric patients. Concerning healthy subjects the investigators have previously shown that anodal tDCS to the right dorsolateral prefrontal cortex (DLPFC) parallel to working memory training can sustainingly enhance performance in a spatial n-back task. Additionally, first translational experiments regarding the use of anodal tDCS to improve working memory (WM) in patients with schizophrenia rendered promising results. On those grounds, the investigators now test the hypothesis that anodal tDCS to the right DLPFC can augment working memory training in patients with schizophrenia.

NCT03621540 Schizophrenia Cognitive Deficits Device: active tDCS Device: sham tDCS Behavioral: Adaptive working memory training
MeSH: Schizophrenia Cogn Cognition Disorders Cognitive Dysfunction
HPO: Cognitive impairment Mental deterioration Schizophrenia

Examination of gene polymorphisms (BDNF Val66Met, COMT Val108Met158; CACNA1C) via polymerase chain reaction (PCR).. Influence of age on tDCS effectiveness. --- Val66Met ---

Primary Outcomes

Description: Use of d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) − Z(false alarm rate).

Measure: Change (post training - pre training) in working memory task performance (1-,2-,3-back).

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of working memory training.

Secondary Outcomes

Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibility and processing speed.

Measure: Change (post training - pre training) in cognitive flexibility and processing speed.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Trail Making Test (TMT) A and B. Results in seconds will be normalized by age and education adjusted standard values. Slower processing time indicates less cognitive flexibilty and processing speed.

Measure: Change (follow-up - pre training) in cognitive flexibility and processing speed.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.

Measure: Change (post training - pre training) in cognition.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Measure of different cognitive domains with the Brief Assessment of Cognition in Schizophrenia (BACS). Subscales (Verbal Memory, Working Memory, Motor Function, Verbal Fluency, Speed of Processing, Executive Function) and composite score. Taking age and gender into account, individual test scores are averaged to standardized scores (z-score) . Higher scores indicate better task performance.

Measure: Change (follow-up - pre training) in cognition.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Use of the d' and response time as dependent variables. Based on signal detection theory, the discriminability index d' (d-prime) is calculated by using the formula d' = Z(hit rate) − Z(false alarm rate).

Measure: Change (follow-up - pre training) in working memory task performance (1-,2-,3-back).

Time: Pre Training: 3-4 days before training start. Follow up: 4 and 12 weeks after completion of working memory training.

Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.

Measure: Change (post training - pre training) in depressive symptoms.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

Description: Calgary Depression Scale for Schizophrenia (CDSS). Maximum score is 27. Higher scores indicate a higher level of depression.

Measure: Change (follow-up - pre training) in depressive symptoms.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.

Measure: Change (post training - pre training) in psychopathology.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Positive and Negative Syndrome Scale (PANSS). The PANSS measures symptom severity on a positive, a negative and a general psychopathology scale. Higher scores indicate more pronounced symptom severity. The PANSS will be analyzed in subscales and as a summed total score.

Measure: Change (follow-up - pre training) in psychopathology.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.

Measure: Change (post training - pre training) in negative symptoms

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

Description: Scale for the Assessment of Negative Symptoms (SANS). The total score is calculated by addition of 5 subscales with a maximum score of 25. A higher score indicates more pronounced negative symptoms.

Measure: Change (follow-up - pre training) in negative symptoms

Time: Pre Training: 3-4 days before training start. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life.

Measure: Change (post training - pre training) in quality of life.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

Description: World Health Organization Quality of Life Questionnaire, short version (WHOQOL-BREF). Four major domains are assessed: physical, psychological, social relationships and environment. It consists of 26 items and a maximum score of 130. Higher scores indicate a higher quality of life

Measure: Change (follow-up - pre training) in quality of life.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training. And changes in follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.

Measure: Change (post training - pre training) in subjective cognitive capacity.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training.

Description: Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS).Scale with 21 items, maximum score of 84, higher scores indicate more subjective cognitive impairment.

Measure: Change (follow-up - pre training) in subjective cognitive capacity.

Time: Pre Training: 3-4 days before training start. Follow-up sessions: 4 and 12 weeks after completion of working memory training.

Description: resting state connectivity, event-related potentials (ERP), 32-channel EEG

Measure: Differences in EEG signatures between interventional arms.

Time: Pre Training: 3-4 days before training start. Post Training: 3-4 days after completion of training

Other Outcomes

Description: Examination of gene polymorphisms (BDNF Val66Met, COMT Val108Met158; CACNA1C) via polymerase chain reaction (PCR).

Measure: Influence of genetic constitution on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

Description: Age in years; demographic questionnaire

Measure: Influence of age on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

Description: Sex: male, female, not specified; self report questionnaire

Measure: Influence of sex on tDCS effectiveness

Time: Pre Training: 3-4 days before training start

32 Network Mediation of Experiential and Expressive Deficits in Psychotic Disorders

The main purpose of this study is to learn how transcranial magnetic stimulation (TMS) helps improve negative symptoms of schizophrenia. These 'negative symptoms' include anhedonia (the inability to enjoy things), low motivation, and decreased facial expression. TMS is a noninvasive way of stimulating the brain. TMS uses a magnetic field to cause changes in activity in the brain. The magnetic field is produced by a coil that is held next to the scalp. In this study we will be stimulating the brain to learn more about how TMS may improve these symptoms from schizophrenia.

NCT03648268 Schizophrenia Negative Type; Schizophrenic Device: repetitive Transcranial Magnetic Stimulation (rTMS)
MeSH: Schizophrenia
HPO: Schizophrenia

Hypothesis: Brain-derived neurotrophic factor (BDNF) homozygous val-allele carriers of the val66met BDNF gene will show greater response than met-carriers. --- val66met ---

Primary Outcomes

Description: We will evaluate the effect of sham vs active rTMS on negative symptom severity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Negative Symptom Severity

Time: Before treatment (Baseline) and 1 week post treatment

Secondary Outcomes

Description: We will evaluate the effect of sham vs active rTMS on cerebellar-prefrontal cortex functional connectivity in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Cerebellar - Prefrontal Functional Connectivity

Time: Before treatment (Baseline) and 1 week post treatment

Description: We will evaluate the effect of sham vs active rTMS on the frequency and severity of auditory hallucinations in the group with Cerebellar targeted rTMS and in the group with DLPFC targeted rTMS

Measure: Change in Auditory Hallucination Severity

Time: Before treatment (Baseline) and 1 week post treatment

33 Effects of BDNF Val66Met Polymorphism on the Efficacy of Aerobic Exercise in Sedentary, Healthy Males

This study investigates whether, after six weeks of exercise, a genetic variant (Val66Met) in the gene that makes a molecule (BDNF) important for brain health and function, influences the beneficial effects of a further session of exercise in sedentary, healthy males. The aim of this research is to determine whether not having this genetic variant (Val66Met) provides an advantage for achieving greater exercise-induced benefits. After six consecutive weeks of exercise (high-intensity interval training (HIIT), three times per week), the effects of a further session of exercise on brain activity are studied in healthy, sedentary males with and without the BDNF genetic variant. Further, whether the BDNF genetic variant impacts the effects of six weeks of aerobic exercise on blood BDNF levels, memory and cardiorespiratory fitness is examined. This data will help to understand whether genetic factors moderate the beneficial effects of exercise. Understanding what factors influence the effectiveness of exercise training programs is essential to individualize exercise programs and maximize their positive effects on the brain and during rehabilitation following brain injuries.

NCT03670186 Quality of Life Behavioral: High-Intensity Interval Training (HIIT)

Effects of BDNF Val66Met Polymorphism on the Efficacy of Aerobic Exercise in Sedentary, Healthy Males. --- Val66Met ---

Effects of Genetic Variation on the Efficacy of Aerobic Exercise This study investigates whether, after six weeks of exercise, a genetic variant (Val66Met) in the gene that makes a molecule (BDNF) important for brain health and function, influences the beneficial effects of a further session of exercise in sedentary, healthy males. --- Val66Met ---

The aim of this research is to determine whether not having this genetic variant (Val66Met) provides an advantage for achieving greater exercise-induced benefits. --- Val66Met ---

The objective of this research is to determine whether after six consecutive weeks of high-intensity interval training (HIIT), three times per week, BDNF Val66Met polymorphism impacts the effects of a further HIIT session on corticospinal excitability as well as intracortical and spinal circuitry. --- Val66Met ---

Additionally, this study aims to assess whether BDNF Val66Met polymorphism moderates the effects of six consecutive weeks of HIIT on BDNF, working memory and cardiorespiratory fitness levels. --- Val66Met ---

Primary Outcomes

Description: Corticospinal excitability as measured by single-pulse TMS-evoked responses in a hand and forearm muscles.

Measure: Corticospinal excitability

Time: 8 weeks

Description: Intracortical circuits as measured by paired-pulse TMS-evoked responses in a hand muscle

Measure: Intracortical circuits

Time: 8 weeks

Description: Spinal circuits as measured by spinal Hoffman reflexes from a forearm muscle

Measure: Spinal circuits

Time: 8 weeks

Description: Serum levels of BDNF as assessed by ELISA

Measure: Blood BDNF

Time: 8 weeks

Secondary Outcomes

Description: Serum levels of cathepsin B as assessed by ELISA

Measure: Cathepsin B

Time: 8 weeks

Description: Serum levels of IGF-1 as assessed by ELISA

Measure: IGF-1

Time: 8 weeks

Description: Serum levels of VEGF as assessed by ELISA

Measure: VEGF

Time: 8 weeks

Description: Serum levels of osteocalcin as assessed by ELISA

Measure: Osteocalcin

Time: 8 weeks

Description: Working memory as assessed by the Automated Operation Span (OSPAN) Task

Measure: Working memory

Time: 8 weeks

Description: Cardiorespiratory fitness as assessed by VO2 peak test

Measure: Cardiorespiratory fitness

Time: 8 weeks

34 Assessing the Effect of Multi-disciplinary Lifestyle Medicine Intervention on Brain-derived Neurotrophic Factor Levels Following Stroke

This is a pilot study to determine whether a lifestyle medicine intervention following stroke may increase levels of Brain-Derived Neurotrophic Factor (BDNF).

NCT03701815 Stroke Behavioral: Wellness in Rehabilitation program
MeSH: Stroke
HPO: Stroke

An single nucleotide polymorphism exists on the BDNF gene in 30-50% of the human population that results in an amino acid change from valine (val) to methionine (met) at position 66 (val66met) of the precursor peptide proBDNF. --- val66met ---

Primary Outcomes

Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured prior to any exercise upon completion of intervention.

Measure: BDNF level - Final

Time: Week 12

Secondary Outcomes

Description: Plasma BDNF protein levels, expressed in nanograms per milliliter, measured immediately following bout of aerobic exercise.

Measure: BDNF level - Post-exercise

Time: Week 6

Description: Genotyping of venous blood samples to determine ValVal, MetMet, and ValMet distribution.

Measure: BDNF Genotype

Time: Baseline

Description: Measured as VO2 max (ml/kg/min).

Measure: Cardiovascular Fitness - VO2 max

Time: Week 12

Description: Measured as estimated metabolic equivalents (kcal/kg/hour).

Measure: Cardiovascular Fitness - METs

Time: Week 12

Description: Total distance walked 6 minutes on a flat surface.

Measure: 6-minute Walk Test

Time: Week 12

35 Cortical Excitability Changes on the Sensorimotor Cortex Induced by Caffeine Consumption: A TMS Study

Caffeine is a widely used psychostimulant drug and acts as a competitive antagonist at adenosine receptors. Its effect is on neurons and glial cells of all brain areas. Chronic consumption of caffeine leads to tolerance which might be associated with an increased number of binding sites in the brain. In deep brain stimulation (DBS), the production of adenosine following the release of adenosine triphosphate (ATP) explains the reduction of in tremor. Binding of adenosine to adenosine A1 receptor suppresses excitatory transmission in the thalamus and thus reduces both tremor-and DBS-induced side effects. Also, the effect of adenosine was attenuated following the administration of the 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX) adenosine A1 receptor antagonist. Therefore, the presence of a receptor antagonist such as caffeine was suggested to reduce the effectiveness of deep brain stimulation (DBS) in treating tremor and other movement disorders. In light with this finding, we anticipate that the antagonistic effect of caffeine is a culprit to the reduction of effectiveness of any stimulation protocol in non-invasive stimulation (NIBS). In particular the excitatory effects of a NIBS protocol can tentatively be blocked in the presence of caffeine. In this study, the effects of caffeine consumption on cortical excitability at the sensorimotor cortex shall be examined on focal and non-focal plasticity. Focal plasticity will be induced by paired associated stimulation (PAS) and global cortical plasticity from transcranial alternating current (tACS) stimulation. In case of tACS stimulation, 1) an excitatory protocol (tACS, 140 Hz, 1 mA) and 2) an inhibitory protocol (tACS, 140 Hz, 0.4 mA) with the active electrode over M1 and the return electrode over the orbitofrontal cortex will be used. Changes in cortical excitability are assessed using transcranial magnetic stimulation (TMS) recordings. Research goals are to examine the effects of caffeine consumption on sensorimotor cortical excitability and stimulation induced plasticity. In addition, this study explores further factors which usually contribute to variability in cortical excitability studies. The results are expected to give a useful recommendation for researchers to reduce confounding factors and hereby improves repeatability.

NCT03720665 Cortical Excitability Brain Stimulation Combination Product: Caffeine_TMS

Val66Met; Val66Val; Met66Met; Met66Val). --- Val66Met ---

Primary Outcomes

Description: Amplitude of motor evoked potential change (MEP)

Measure: Cortical excitabiliy changes induced by caffeine consumption

Time: Baseline (pre-measurement), immediately after intervention, 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 60 minutes

Secondary Outcomes

Description: Valine (Val) and Methionine (Met) alleles (i.e. Val66Met; Val66Val; Met66Met; Met66Val)

Measure: Brain-derived neurotrophic factor (BDNF) gene polymorphisms on cortical plasticity

Time: 3-6 months

36 The Role of Sex Steroids and Serotonin Brain Dynamics in Perinatal Mental Health

Hormonal transitions such as across pregnancy and postpartum may trigger depressive episodes in some women. It is not known why, but estrogen sensitivity may play a critical role. A preclinical human risk model showed that depressive symptoms induced by pharmacological sex-hormone manipulation is linked to increases in serotonin transporter (SERT) brain binding, which lowers serotonergic brain tone. It is currently unknown if these findings translates to women across pre- to postpartum transitions. This longitudinal project studies a group of women who will deliver by planned caesarian, thus permitting the collection of cerebrospinal fluid (csf) containing central markers of serotonergic signaling, at the latest point in pregnancy. The women are followed across late pregnancy, delivery and 6 months postpartum to illuminate relations between sex-hormones, stress-regulation, estradiol sensitivity, csf markers of neurotransmission, serotonin transporter genotype variance, and potential development of subclinical or manifest depressive symptoms. Further, markers of relevance for the infant brain development and stress-regulation will be obtained from placenta tissue and umbilical cord blood. A subgroup of 70 women will participate in a brain imaging program early postpartum (week 3-5), which includes an evaluation of brain activity and structure and in vivo molecular brain imaging serotonergic markers. Thus, serotonergic markers in csf can be combined with postpartum molecular brain imaging of key features of serotonin signaling. Women in the imaging program are selected based on variation in their level of mental distress immediately postpartum (day 2-5). The study's main hypothesis is that women with high-expressing SERT genotypes are more sensitive to peripartum hormonal transition in terms of changes in serotonergic tone and emergence of depressive symptoms and that such an association will be stronger in the presence of candidate gene transcript biomarkers of oestrogen sensitivity. A further hypothesis is that in vivo molecular brain imaging and csf based serotonergic markers will be associated with depressive symptoms both early and later postpartum. Ideally, this project will provide a rationale for future targeted prevention and/or treatment of perinatal depression in women at high risk, which holds grand potential to protect not only mother but also infant brain health long-term.

NCT03795688 Major Depressive Disorder Perinatal Depression Other: Pregnancy
MeSH: Depressive Disorder Depressive Disorder, Major
HPO: Depressivity

BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status. --- val66met ---

Primary Outcomes

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Total group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 3-6 postpartum

Description: 116 a priori defined gene transcripts, which where differentially expressed in third trimester of women who later developed perinatal depression with postpartum onset relative to pregnant women who did not and to other depressed (reference Mehta et al, 2014, Psychological Medicine) and confirmed to be coupled to estrogen fluctuations (Mehtaet al. 2018 British Journal of Psychiatry) will be evaluated in the total group. Also DNA methylation of the genes of these transcripts will be determined and analysed in terms of their predictive value (above chance) for perinatal depression.

Measure: Gene transcript and DNA methylation markers of estrogen sensitivity

Time: Prior to caesarean section

Description: Latent variable construct of brain 5-HT4R level based on quantification of 5-HT4R binding from 11C-SB207145 positron emission tomography in primary volumes of interest; neocortex, nucleus caudatus, putamen and hippocampus. Assessed in imaging group.

Measure: Cerebral serotonin 4 receptor binding postpartum

Time: Week 3-6 postpartum

Description: Assessed in total group

Measure: CSF levels of GABA

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of serotonin metabolite (5-HIAA)

Time: On day of caesarean section

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 3-6 postpartum

Description: Provides an estimate of cortisol exposure up to 6 months prior to delivery, total group

Measure: Hair cortisol level mothers

Time: On day of caesarean section.

Description: Provides an estimate of fetal cortisol exposure, infants from total group

Measure: Hair cortisol level newborns

Time: Day 0-5 postpartum.

Description: Hippocampal brain volume (including hippocampus) from structural MRI, imaging group.

Measure: Hippocampal volumes

Time: Week 3-6 postpartum.

Description: fMRI (BOLD response) based assessment of brain activity in response to reward, relative to non-reward, stimuli. Assessed in imaging cohort

Measure: functional MRI response to reward

Time: Week 3-6 postpartum.

Description: rsfMRI based spontaneous co-fluctuations in low frequency BOLD signal, (functional connectivity). Assessed with rsfMRI scan in the resting state, i.e. non-goal oriented spontaneous thought and awake. Assessed in imaging group.

Measure: Resting state functional connectivity MRI

Time: Week 3-6 postpartum

Description: Change in epigenetic SERT status from late pregnancy to postpartum week 3-6.

Measure: Change in epigenetic SERT status

Time: From just before delivery to 3-6 weeks postpartum

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Concentration of inflammatory markers, i.e hsCRP and immunoactive cytokines, in peripheral blood

Time: At week 3-6

Description: fMRI (BOLD response) based assessment of brain activity to emotionally salient, relative to neutral, stimuli. Assessed in imaging cohort.

Measure: functional MRI response to emotional faces

Time: Week 3-6 postpartum.

Secondary Outcomes

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

Description: Score on the Hamilton 17-item depression scale. Score range: 0-52. Higher scores indicate more depressive symptoms. Assessed in imaging group

Measure: Depressive symptoms

Time: Week 12 postpartum

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in total group

Measure: Depressive symptoms

Time: Day 3-5 postpartum

Description: Edinburgh Postnatal Depression Scale. Score range: 0-30. Higher scores indicate more symptoms of postpartum depression. Assessed in all

Measure: Depressive symptoms

Time: 6 months postpartum

Description: Assessed in total group

Measure: CSF levels of serotonin

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of dopamine metabolites

Time: On day of caesarean section

Description: Assessed in total group

Measure: CSF levels of noradrenaline metabolites

Time: On day of caesarean section

Description: Composite measure of IFN-c, IFN-alfa TNF-alfa og IL-6, in total group

Measure: CSF levels of inflammatory markers

Time: On day of caesarean section

Description: Estradiol level in peripheral blood, total group

Measure: Estradiol level

Time: Prior to caesarean section.

Description: Estradiol level peripheral blood, total group

Measure: Estradiol level

Time: At week 3-6 postpartum.

Description: Estradiol change pre- to postpartum, peripheral blood total group

Measure: Change in estradiol level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: Prior to caesarean section.

Description: Progesterone level in peripheral blood

Measure: Progesterone level

Time: At week 3-6 postpartum.

Description: Progesterone change pre- to postpartum, peripheral blood total group

Measure: Change in progesterone level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: Prior to caesarean section.

Description: Allopregnanolone level in peripheral blood

Measure: Allopregnanolone level

Time: At week 3-6 postpartum.

Description: Change in allopregnanolone level in peripheral blood

Measure: Change in allopregnanolone level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Cortisol change pre- to postpartum, peripheral blood total group

Measure: Change in cortisol level

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Week 12 postpartum

Description: Cortisol awakening response, area under the curve with respect to baseline from 0 to 60 minutes from awakening.

Measure: Cortisol awakening response

Time: Prior to caesarean section

Description: Change in cortisol awakening response, from caesarean section to 3-6 weeks postpartum.

Measure: Change in cortisol awakening response

Time: ´From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Prior to caesarean section

Description: DNA Methylation status for the SERT gene, total group

Measure: DNA methylation of the SERT gene

Time: Week 3-6 postpartum

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Prior to caesarean section.

Description: Methylation status for the FK506-binding protein 51 (FKBP5) gene, total group

Measure: DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the FK506-binding protein 51 (FKBP5) gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the FK506-binding protein 51 (FKBP5) gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Prior to caesarean section.

Description: Methylation status for the glucocorticoid receptor gene, total group

Measure: DNA methylation of the glucocorticoid receptor gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the glucocorticoid receptor gene from late pregnancy to postpartum week 3-6.

Measure: Change in DNA methylation of the glucocorticoid receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Prior to caesarean section.

Description: Methylation status for the COMT gene, total group

Measure: DNA methylation of the COMT gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the COMT gene from just before delivery to 3-6 weeks postpartum

Measure: Change in DNA methylation of the COMT gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Prior to caesarean section.

Description: Change in methylation status for the MAO-A gene, total group

Measure: Change in DNA methylation of the MAO-A gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the MAO-A gene, total group

Measure: DNA methylation of the MAO-A gene

Time: Week 3-6 postpartum

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Prior to caesarean section.

Description: Methylation status for the oxytocin receptor gene, total group

Measure: DNA methylation of the oxytocin receptor gene

Time: Week 3-6 postpartum

Description: Change in methylation status for the oxytocin receptor gene, total group

Measure: Change in DNA methylation of the oxytocin receptor gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Prior to caesarean section.

Description: Methylation status for the oxytocin gene, total group

Measure: DNA methylation of the oxytocin gene

Time: Week 3-6 postpartum

Description: Change methylation status for the oxytocin gene, total group

Measure: Change in DNA methylation of the oxytocin gene

Time: From baseline (caesarean section to week 3-6 postpartum)

Description: Composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: Prior to caesarean section.

Description: Change in composite measure of hsCRP, TNF-α, IL-6, IL-18 and IL-10 levels, total group

Measure: Change in systemic inflammation peripheral blood hsCRP and immunoactive cytokines

Time: From baseline (caesarean section to week 3-6 postpartum

Description: Family History Assessment Module (OS-FHAM). Number of first degree relatives with a history of depressive episodes or bipolar disorder. Total group.

Measure: Self reported family history of mood disorders

Time: Day 3-5 postpartum or before

Description: Barratt Impulsiveness Scale (BIS-11), self-reported. Range: 30-120. Total group.

Measure: Self reported impulsiveness score

Time: Day 3-5 postpartum or before

Description: NEO-PI-R - Revised NEO Personality Inventory, self-reported. Participants may score 20-80 for each of the personality traits: openness, conscientiousness, extraversion, agreeableness, and neuroticism. The higher the score, the more prominent is the personality trait. Total group.

Measure: Self reported Neuroticism score from NEO personality questionnaire

Time: Day 3-5 postpartum or before

Description: Parental bonding instrument (PBI), both parents, self-reported. Total group.

Measure: Self reported parental bonding quality

Time: Day 3-5 postpartum or before

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Day 3-5 postpartum

Description: Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Self-reported perceived stress

Time: Week 3-6 postpartum

Description: Change in Perceived Stress Scale (PSS), range 0-40, a score of 0 indicates no perceived stress. Total group.

Measure: Change in self-reported perceived stress

Time: Change from day 3-5 to week 3-6 postpartum

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Day 3-5 postpartum

Description: Snaith-Hamilton Pleasure Scale (SHAPS), range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Self-reported anhedonia

Time: Week 3-6 postpartum

Description: Change in Snaith-Hamilton Pleasure Scale (SHAPS) score, range 0-14, a score of 0 indicates no self-reported anhedonia. Total group.

Measure: Change in self-reported anhedonia

Time: Change from day 3-5 to week 3-6 postpartum

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Day 3-5 postpartum

Description: Rumination Response Scale (RRS), range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Self-reported rumination

Time: Week 3-6 postpartum

Description: Change in Rumination Response Scale (RRS) score, range 22-88, a score of 22 indicates no ruminative symptoms. Total group.

Measure: Change in elf-reported rumination

Time: Change from day 3-5 to week 3-6 postpartum

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Day 3-5 postpartum

Description: Profile of Mood States (POMS), range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Self-reported mood

Time: Week 3-6 postpartum

Description: Change in Profile of Mood States (POMS) score, range 0-260, a score of 0 indicates no mood disturbance. Total group.

Measure: Change in self-reported mood

Time: Change from day 3-5 to week 3-6 postpartum

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Day 3-5 postpartum

Description: Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Self-reported sleep quality

Time: Week 3-6 postpartum

Description: Change in Pittsburgh Sleep Quality Index (PSQI), range 0-21, a score of 0 indicates a healthy sleep quality. Total group.

Measure: Change in self-reported sleep quality

Time: Change from day 3-5 to week 3-6 postpartum

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Day 3-5 postpartum

Description: Brief symptom Inventory-53 item (BSI-53), range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Self-reported psychiatric symptoms

Time: Week 3-6 postpartum

Description: Change in Brief symptom Inventory-53 item (BSI-53) score, range 0-212, increasing score means worsening of symptoms.Total group.

Measure: Change in self-reported psychiatric symptoms

Time: Change from day 3-5 to week 3-6 postpartum

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Day 3-5 postpartum

Description: WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Self-reported well-being

Time: Week 3-6 postpartum

Description: Change in WHO-5 well-being index, range 0-100, low score means less well-being. Total group.

Measure: Change in self-reported well-being

Time: Change from day 3-5 to week 3-6 postpartum

Description: State Trait Anxiety Inventory (STAI-AD-D), state and trait subscales each have a range of 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Day 3-5 postpartum

Description: State Trait Anxiety Inventory (STAI-AD-D), state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Self-reported anxiety

Time: Week 3-6 postpartum

Description: Change in State Trait Anxiety Inventory (STAI-AD-D) score, state subscale range 20-80, 20 means no anxiety. Total group.

Measure: Change in self-reported anxiety

Time: Change from day 3-5 to week 3-6 postpartum

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Day 3-5

Description: Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Self-reported obsessive and compulsive symptoms

Time: Week 3-6 postpartum

Description: Change in Obsessive-Compulsive Inventory (OCI) score, self-reported, range 0-72, higher scores indicate more symptoms. Total group.

Measure: Change in self-reported obsessive and compulsive symptoms

Time: Change from day 3-5 to week 3-6 postpartum

Description: Performance on Simple Reaction Time, in imaging cohort.

Measure: Performance on Simple Reaction Time

Time: Week 3-6 postpartum

Description: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Measure: Gray matter brain volume prefrontal cortex and anterior cingulate cortex

Time: At week 3-6 postpartum

Description: Composite measure of serotonin, tryptophan og tryptofan hydroxylase levels relative to 5-HIAA, in placenta sample. Infants from total group

Measure: Serotonergic turnover in placenta

Time: At delivery.

Description: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta. Infants from total group

Measure: 11-beta-hydroxysteroid dehydrogenase type 2 activity in placenta

Time: At delivery

Description: Composite measure of methylation status for the FKBP5, glucocorticoid receptor, 11-beta hydroxysteroid dehydrogenase type 2 genes. Infants from total group

Measure: Methylation status of genes relevant for stress-hormone regulation in placenta

Time: At delivery

Description: Composite measure of the methylation status for monoamine oxidase, serotonin receptor and serotonin transporter genes. Infants from total group

Measure: Methylation status of genes related to serotonergic signaling in placenta

Time: At delivery

Description: Composite measure of methylation status and gene transcript profiles of Glucocorticoid receptor, FKBP5, oxytocin and oxytocin receptors, Brain-derived neurotrophic factor (BDNF) genes. Assessed in blood from umbilical cord blood sample from infants, total group.

Measure: Methylation status and gene transcript profiles of relevance for early brain development and stress regulation in newborn infants

Time: At delivery.

Other Outcomes

Description: val158met (rs4680) status, binary variable, i.e. "val/val, val/met" vs "met/met" variants

Measure: COMT-genotype (rs4680) variant, i.e met/met vs other polymorphisms

Time: Prior to caesarean section.

Description: BDNF val66met (rs6265) status, binary variable, i.e. "val/val" versus "met-carrier" status

Measure: BDNF genotype (rs6265) status, i.e. val/val versus met-carrier variants

Time: Prior to caesarean section.

Description: 5-HTTLPR genotype status (binary), i.e. high-expressing LALA vs low-expressing (S or LG) variants, based on SLC6A4, i.e. L or S variants, and further subtyping on rs25531 haplotype L(A)L(A) vs LGLA, LGLG or variants containing as S as specified above.

Measure: 5-HTT genotype status, i.e LALA vs low-expressing (S or LG) variants

Time: Prior to caesarean section.

Description: In house interview based on Kennerley Maternity Blues Questionnaire, range: 0-28, higher score indicates more severe postpartum blues symptoms. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

Description: In house interview based on Stein's Maternity Blues Scale, range 0-26. High blues score is associated with greater risk for perinatal depression at week 3-6.

Measure: Postpartum blues symptoms

Time: Day 3-5 postpartum.

37 Assessing Cognitive Improvements, Brain Neuroplasticity and the Role of Genetic Factors After Aerobic Exercise in Sedentary Adults

The overall goal of the proposed study is to evaluate the effects of an 8-week aerobic exercise program on cognition and determine the relationship between cognitive improvements and Transcranial Magnetic Stimulation (TMS) neuroplasticity. The investigators will also explore the effect modification of BDNF levels and BDNF allelic status, and APOE4 status on cognitive response after exercise.

NCT03804528 Sedentary Behavior Behavioral: Aerobic Exercise

Genetic testing will be performed to assess for brain-derived neurotrophic factor (BDNF) Val66Met polymorphism.. Allelic Status APOE. --- Val66Met ---

Primary Outcomes

Description: An index of the duration of the Theta-Burst Stimulation (TBS) induced modulation of corticospinal excitability (the time-point at which the normalized mean Motor Evoked Potential (MEP) amplitude returns to baseline values) will be defined for each participant.

Measure: Change in TMS Plasticity Measures

Time: baseline and after 8 weeks of exercise

Description: Cognitive performance will be assessed using a neuropsychological test battery in executive function, processing speed, learning, and language.

Measure: Change in Cognitive Performance

Time: baseline and after 8 weeks of exercise

Secondary Outcomes

Description: Blood samples will be collected for BDNF levels.

Measure: Changes in BDNF Levels

Time: baseline and after 8 weeks of exercise

Description: A maximal treadmill test will be performed to determine maximal oxygen uptake (VO2) as a measure of aerobic capacity.

Measure: Change in Aerobic Capacity (Cardiovascular Fitness)

Time: baseline and after 8 weeks of exercise

Description: Genetic testing will be performed to assess for brain-derived neurotrophic factor (BDNF) Val66Met polymorphism.

Measure: Allelic Status BDNF

Time: baseline

Description: Genetic testing will be performed to assess for the presence of apolipoprotein-E (APOE) e4 allele.

Measure: Allelic Status APOE

Time: baseline

38 Clinical, Psychological and Genetic Characteristics of Patients With Atopic Dermatitis and Psoriasis

Atopic dermatitis (AD) and psoriasis (PS) are chronic, relapsing dermatological disorders with a high rate of psychiatric co-morbid pathology represented with depression. Brain Derived Neurotrophic Factor (BDNF) belongs to the neurotrophin family and widely studied in pathophysiology of psychiatric and dermatological disorders. A biological stress response system by altered hypothalamic-pituitary-adrenal (HPA) axis as well hypothalamic-pituitary-gonadal (HPG) axis may contribute to dermatoses and psychiatric disorders development. Various factors including gender, genetic, psychological stress, socioeconomic factors also affect the course of dermatoses. A 10-week, case-control study evaluate clinical, psychological and biochemical parameters in AD and PS patients, and healthy control volunteers (HC) depending on gender and BDNF rs6265 gene polymorphism. All parameters are evaluated twice: at disease exacerbation (study baseline) and week 10. The following methods are conducted: assessment of dermatological status, using Scoring of Atopic Dermatitis (SCORAD) and Psoriasis Area and Severity Index (PASI); assessment of depression and anxiety according to DSM-V criteria and with Hamilton Depression Rating Scale (HAM-D) and with Hamilton Anxiety Rating Scale (HAM-A); analysis of serum BDNF (ng/ml), cortisol (nmol/L), testosterone (ng/dL) and IgE levels (IU/ml, AD only); DNA extraction and genotyping of BDNF variants.The study will last during 4-5 months.

NCT03831646 Atopic Dermatitis Psoriasis
MeSH: Dermatitis, Atopic Psoriasis Dermatitis Eczema
HPO: Atopic dermatitis Eczema Eczematoid dermatitis Inflammatory abnormality of the skin Palmoplantar pustulosis Psoriasiform dermatitis

DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC. --- Val66Met ---

Primary Outcomes

Description: Assessment of atopic dermatitis severity is conducted using Scoring of Atopic Dermatitis (SCORAD) index. SCORAD index formula is: A/5 + 7B/2 + C. In this formula A is defined as the extent (0-100), B is defined as the intensity (0-18) and C is defined as the subjective symptoms (0-20). The maximum SCORAD score is 103. SCORAD <23 - mild AD; SCORAD from 23 to 63 - moderate AD; SCORAD> 63 - severe AD.

Measure: Assessment of change in the severity of atopic dermatitis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

Description: Assessment of the psoriasis severity is conducted using Psoriasis Area and Severity Index (PASI). The patient's body is divided into four sections (head (H) (10% of a person's skin); arms (A) (20%); trunk (T) (30%); legs (L) (40%)). The percent of skin lesions of each area is assessed as follows: 0 (0% of involved area); 1 (< 10%); 2 (10-29%); 3 (30-49%); 4 (50-69%); 5 (70-89%); 6 (90-100%). Further, for each region, the intensity of 3 clinical signs is evaluated - redness, thickness and scaling and assessed as follows: 0 - no lesions,1 - easy, 2 - moderate, 3 - severe, 4 - very severe. The sum of all three severity parameters is calculated for each section, multiplied by the area score for that area and multiplied by weight of respective section (0.1 for head, 0.2 for arms, 0.3 for body, 0.4 for legs). PASI range is from 0 (no disease) to 72 (maximum disease). The severity of psoriasis is assessed as follows: PASI <20 - mild; PASI from 20 to 50 - moderate; PASI> 50 - severe

Measure: Assessment of change in the severity of psoriasis after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and at week 10

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of change in the severity of depression in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

Description: Depression is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Depression Rating Scale (HAM-D) using the following ranges: absence, ≤7; mild, 8-16; moderate, 17-27; severe, ≤28

Measure: Assessment of the severity of depression in healthy controls (HC)

Time: At disease onset (study baseline)

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of change in the severity of anxiety in atopic dermatitis and psoriasis patients after conventional treatment from study onset (baseline) at week 10

Time: At disease onset (study baseline) and week 10

Description: Anxiety is assessed according to Diagnostic and Statistical Manual of Mental Disorders (DSM) -V criteria and with Hamilton Anxiety Rating Scale (HAM-A) using the following ranges: ≤17, easy; 18-24, moderate; over 25, medium-severe

Measure: Assessment of the severity of anxiety in HC

Time: At disease onset (study baseline)

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Evaluation of changes in serum immunoglobulin E (IgE, IU/ml) levels from study onset (baseline) at week 10 in atopic dermatitis patients

Time: At disease onset (study baseline) and week 10

Description: The total IgE levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 0.000-100.0 IU/ml

Measure: Analysis of serum IgE (IU/ml) levels in HC

Time: At disease onset (study baseline)

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Evaluation of changes in serum Brain Derived Neurotrophic Factor (BDNF, ng/ml) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Description: Serum BDNF levels are analyzed using a solid-phase, sandwich, two-site, ELISA (Promega, US; G7610). No measurement scale is used

Measure: Analysis of serum BDNF (ng/ml) levels in HC

Time: At disease onset (study baseline)

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Evaluation of changes in cortisol (nmol/L) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Description: The total cortisol levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: 138-690 nmol/L

Measure: Analysis of serum cortisol (nmol/L) levels in HC

Time: At disease onset (study baseline)

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Evaluation of changes in testosterone (ng/dL) levels from study onset (baseline) at week 10 in atopic dermatitis and psoriasis patients

Time: At disease onset (study baseline) and week 10

Description: The total testosterone levels are detected using solid-phase, chemiluminescent immunometric assay in an Immulite/Immulite 1000 (Siemens, Germany). Normal ranges are as follow: men 20-49 years - 72 -853ng/dL; men≥50 years -129-767 ng/dL; women ovulating - 0.010-73.0 ng/dL; women postmenopausal - 0.010-43.0 ng/dL.

Measure: Analysis of serum testosterone (ng/dL) levels in HC

Time: At disease onset (study baseline)

Description: DNA extraction and genotyping the BDNF rs6265 (Val66Met) gene polymorphism in AD, PS and HC

Measure: DNA extraction in AD, PS and HC

Time: At disease onset (study baseline)

Secondary Outcomes

Description: EAD and IAD patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of SCORAD scores compared with baseline after conventional treatment at week 10 in each group using unpaired t-test

Measure: Assessment and comparison (Unpaired t-test) of SCORAD scores in extrinsic atopic dermatitis (EAD, IgE level above the normal) and intrinsic atopic dermatitis (IAD, normal IgE level) patients compared with baseline after conventional treatment at week 10

Time: At disease onset (study baseline) and week 10

Description: Psoriasis patients will be divided into subgroups in accordance with BDNF gene polymorphism and gender with following assessment of PASI scores compared with baseline after conventional treatment at week 10 in each group.

Measure: Assessment and comparison (Unpaired t-test) of PASI scores in psoriasis patients compared with baseline after conventional treatment at week 10 in accordance with BDNF gene polymorphism (Val/Val; Val/Met;Met/Met) and gender(males, females)

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-D scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-D scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-D scores in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of HAM-A scores in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of HAM-A scores in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of HAM-A scores in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum BDNF(ng/ml) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum BDNF levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum BDNF (ng/ml) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for comparisons of serum cortisol (nmol/L) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum cortisol levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum cortisol (nmol/L) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of serum testosterone levels in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of serum testosterone (ng/dL) levels in EAD, IAD,PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC divided into BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, females) at study baseline and week 10

Measure: Assessment of testosterone/cortisol ratio in EAD, IAD, PS patients and HC in accordance with BDNF rs6265 gene polymorphism and gender

Time: At disease onset (study baseline) and at week 10

Description: Unpaired, two-way ANOVA and Bonferroni means separation tests will be used for multiple comparisons of testosterone/cortisol ratio in EAD, IAD and PS patients and HC divided into subgroups in accordance with BDNF gene polymorphism and gender at disease onset (baseline) and week 10. Comparisons will include assessment of testosterone/cortisol ratio in all patients at baseline and week 10 compared with HC, and assessment of data changes at week 10 compared with baseline

Measure: Unpaired, two-way ANOVA and Bonferroni means separation tests for multiple comparisons of testosterone/cortisol ratio in EAD, IAD, PS and HC

Time: At disease onset (study baseline) and at week 10

Description: Correlation analysis of dermatological, psychological and biochemical parameters in EAD, IAD and PS patients, and HC divided into groups in accordance with BDNF rs6265 gene polymorphism (Val/Val; Val/Met; Met/Met) and gender (males, femaes)

Measure: Correlation analysis of studied parameters in dermatological patients and HC

Time: At disease onset (study baseline) and week 10

39 Dual Transcranial Direct Current Stimulation (dTDCS)-Enhanced Therapy After Hemorrhagic Strokes and VEGF

This study will evaluate the feasibility of dual tDCS to improve arm motor function in chronic stroke patients. In addition it will collect pilot data on the blood biomarkers associated with treatment effect.

NCT03857243 Hemorrhagic Stroke Hemiparesis Device: dual transcranial direct current stimulation
MeSH: Stroke Paresis Intracranial Hemorrhages
HPO: Cerebral hemorrhage Hemiparesis Intracranial hemorrhage Stroke

Since in animal models VEGF and BDNF have a complimentary role, VEGF polymorphism may explain some of the variability in strength of association between BDNF polymorphism Val66Met and recovery. --- Val66Met ---

Primary Outcomes

Description: any adverse events that might be related to study procedures

Measure: Adverse Events

Time: enrollment to 3 month followup

Description: Upper extremity motor impairment scale. Scale ranges from 0 (worst, can not perform any tasks) to 66 ( performs all tasks fully).

Measure: Upper Extremity Fugl-Meyer Score

Time: change between before and 3 months follow-up

Secondary Outcomes

Description: Timed performance of 15 functional upper extremity tasks, 0-120 seconds, and 2 strength measures. WMFT time measurements are calculated as the arithmetic mean of rate of performance, where we calculate "how many times would a person have completed the task, had he or she been performing it continuously for 60 seconds". Therefore the results have a minimum score of 0, where the subject could not perform any of the tasks, and no pre-defined maximum score, the higher the rate score the faster the subject was able to perform the tasks. ( see Hodics et al.,2013)

Measure: Wolf Motor Function Test

Time: change between before and at 3 months follow-up

40 Study of Brain Derived Neurotrophic Factor (BDNF) Pathway Biomarkers in the Cerebrospinal Fluid in Patients With Huntington's Disease

Huntington disease (HD, 1.3/10 000) is an autosomal dominant disease due to an abnormal expansion of CAG triplets in HTT gene. Several pathophysiological mechanisms have been evoked, including an alteration of the signaling pathway of the Brain Derived Neurotrophic Factor (BDNF), a neurotrophic factor involved in the survival of neurons (striatal and hippocampal) and synaptic plasticity. BDNF is synthesized at the level of cortical neurons and transported, through the axonal transport in which the Htt is involved, to the nerve endings; it's then secreted in response to excitatory synaptic activity, especially at the level of glutamatergic synapses. Besides, at the postsynaptic level it binds with great specificity to TrkB receptors (tropomyosin-related kinase receptors B) with a neuroprotective effect on dendritic and axonal growth and an increase in synaptic plasticity, especially at the level of the striatum and the hippocampus. BDNF is decreased in the brain of animal models, as well as in patients with HD; the alteration of this pathway would occur in the early stages of the disease. In the context of concomitant multiple treatments, the BNDF pathway may be one of the therapeutic targets of HD. Moreover, in HD it remains essential to detect biological markers representative of the different pathogenic pathways that can be tested in vivo in humans to confirm the hypotheses developed at the level of basic research; these biomarkers could subsequently become biomarkers of disease progression and/or biomarkers of therapeutic efficacy of potential targeted treatments. Therefore, this study aims to characterize potential biomarkers of the BNDF pathway in plasma and CSF in subjects with HD and to confirm the importance of this pathogenic mechanism in vivo in humans.

NCT04012411 Huntington Disease Procedure: Brain MRI Procedure: Lumbar Punction Genetic: Blood sample Other: Cognitive evaluation
MeSH: Huntington Disease

Patients group: in 90 patients with HD, the investigators will perform: a collection of the main anamnestic and clinical data; a blood test for the determination of plasmatic BDNF, Tau and NFL and the genotyping of the Val66Met polymorphism of the BDNF gene; multimodal brain MRI with volumetry, diffusion tensor, functional MRI of rest; a measurement of the UHDRS and Total Functional Capacity scales; neuropsychological tests (SDMT, STROOP test, Trail Making Test (TMT) A and B, digit span). --- Val66Met ---

Primary Outcomes

Description: centralized ELISA assay with Simoa - Quanterix kit technology at the Laboratory of Clinical Proteomic Biochemistry of Montpellier, France.

Measure: BDNF(csf) in HD subjects compared to age-matched control subjects (+/- 5 years)

Time: Inclusion

Secondary Outcomes

Measure: plasmatic BDNF in HD subjects vs controls

Time: Inclusion

Measure: Correlation between BDNF in CSF and BDNF in plasma

Time: Inclusion

Description: Correlation between BDNF in CSF or plasma and: disease severity, assessed through the Huntington Disease Rating Scale (UHDRS), the disease burden formula [(n.CAG-35.5) x age], the Total Functional Capacity functional scale (TFC), and cognitive scales (Symbol Digit Modalities Test, STROOP test, Trail Making test A and B, direct and indirect digit span); - MRI brain imaging: cerebral and striatal atrophy by morphological imaging, functional resting state MRI, and anatomical connectivity by diffusion tensor imaging

Measure: Correlation between BDNF and disease parameters

Time: Inclusion

Measure: Total Tau and NFL levels in plasma and CSF in HD subjects vs control subjects

Time: Inclusion

Measure: TrkBcsf level in subjects with HD vs control subjects

Time: Inclusion

41 Effects of the Combined Cognitive Training and Aerobic Exercise on Cognition, Physiological Markers, Daily Function, and Quality of Life in Stroke Patients With Mild Cognitive Impairment

Cognitive impairments have severe impact on functional recovery and quality of life after stroke. Current evidence indicated that combining exercise and cognitive training may provide additional benefits on cognition in stroke. This study aims to investigate the effects and mechanisms of two combined methods of computer-based cognitive training with physical exercise in stroke patients with cognitive impairments.

NCT04012866 Stroke Behavioral: Aerobic exercise training Behavioral: Computerized cognitive training Behavioral: Control training
MeSH: Stroke
HPO: Stroke

The Task-based EEG will be collected when participants perform the n-back task before and after the intervention program to examine the effects of training on neural plasticity.. BDNF val66met genotype. --- val66met ---

Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.. Serum BDNF level. --- val66met ---

Primary Outcomes

Description: The Mini-Mental State Exam (MMSE) is used to screen patients for cognitive impairment, track changes in cognitive functioning over time, and often to assess the effects of therapeutic agents on cognitive function. Its range of total score is 0-30 with higher values indicating better cognitive function.

Measure: Change scores of Mini-Mental State Exam (MMSE)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Montreal Cognitive Assessment (MoCA) will be used to assess general cognitive functions. It examines several cognitive domains with a total score of 30 and higher values indicate better cognitive functions. The MoCA has been shown to be a valid and promising tool to evaluate the global cognitive function in patients with stroke. The psychometric properties of MoCA are good to excellent for patients with cerebrovascular diseases.

Measure: Change scores of the Montreal Cognitive Assessment (MoCA).

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Several subtests of Wechsler Memory Scale - Third Edition (WMS-III) including Faces Recognition (total scale=48), Verbal Paired Associates (total scale = 32), Word Lists (total scale = 48), and Spatial Span (total scale=32) will be used to assess the immediate, delayed, and working memory tests. For each subtest, a higher number indicates better performance in memory function. The raw score of subtests will also be transferred to standardized Z scores and summed to represent an index of general memory function.

Measure: Change scores of Wechsler Memory Scale - Third Edition (WMS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Wechsler Adult Intelligence Scale - Third Edition (WAIS-III) is developed to measure an individual's intelligence level. The Digit Symbol-Coding (score range 0-133) and Matrix Reasoning (range 0-26) subtests will be used.A higher score indicating better performance. The raw score of each subtest will also be transferred to standardized Z scores and summed to represent an index of general cognitive function.

Measure: Change scores of Wechsler Adult Intelligence Scale - Third Edition (WAIS-III)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The UFOV is a computer-based visual test containing three subtests: visuomotor processing speed, divided attention, and selective attention (Ball, Edwards, & Ross, 2007). The UFOV has been shown to have good test-retest reliability and validity to assess patients with stroke (George & Crotty, 2010).

Measure: Change scores of Useful Field of View (UFOV)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Stroop Color-Word test assesses the abilities of selective attention, inhibition and executive function. The participants will be tested under congruent and incongruent conditions. In the congruent condition, the participant will name the color ink of a word which is consistent with the written color name; whereas in the incongruent condition the participant will name the color ink differs from the written color name. In both conditions, the number of colors correctly named within 45 seconds will be measured and the performance in the congruent condition will be compared with the incongruent condition (Quaney et al., 2009).

Measure: Change scores of Stroop Color-Word Test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Dual-Task test evaluates the ability of set-shifting. Participants will sit and perform the box and block test (BBT) or walk 10 meters while doing secondary cognitive or motor tasks. Two cognitive secondary tasks will be performed by the participants: (1) arithmetic task: participants will be asked to perform serial subtractions by 7 starting from 100 or random two-digit numbers (e.g., Baetens et al., 2013); (2) tone discrimination task: participants will be presented a number of low and high-pitched tones and they will respond to either the high or low-pitched tones during the trial. Both cognitive task performances will be recorded and the results will be compared to single cognitive task performance. In addition to the cognitive dual-task, participants will perform a motor task (e.g., holding a cup of water) while walking.

Measure: Change scores of Dual-Task test

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The TUG assesses the dynamic balance ability and mobility. The participants will be required to stand up from a chair, walk 3 meters, turn around, walk back to the chair, and sit down. The test-retest reliability of TUG on individuals with stroke was excellent (Ng & Hui-Chan, 2005).

Measure: Change scores of Timed Up and Go Test (TUG)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The 6MWT measures the maximum distance walked over 6 minutes, which assess the endurance and mobility level of the participants. The participants could rest as needed during the course of the test. The test-retest reliability and responsiveness has been established to be high for patients with chronic stroke (Fulk, Echternach, Nof, & O'Sullivan, 2008).

Measure: Change scores of Six-Minute Walk Test (6MWT)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: Accelerometers will be used to provide an objective measure of the amount of arm movements in real-life situations. The participants will be asked to wear an Actigraphy activity monitor (ActiGraph, Shalimar, FL, USA) on both wrists for 3 consecutive days before and after training to measure the number of moves each minute, and the average counts of move per minute. The participants will be required to wear the device during the day except for doing water-based activities, such as bathing or swimming.The use of actigraphy to measure arm use and physical activity has been established for patients with stroke (Freedson, Melanson, & Sirard, 1998; Maguire et al., 2012).

Measure: Change scores of Mobility Level

Time: Baseline, posttest (an expected average of 3 months)

Description: The short form version of International Physical Activity Questionnaires (IPAQ) assesses sitting, walking, moderate-intensity activities and vigorous intensity activities. Frequency (measured in days per week) and duration (time per day) are collected separately and transferred to MET-minutes values for each specific type of activity. A combined total physical activity MET-min/week can be computed as the sum of Walking + Moderate + Vigorous MET-min/week scores. Higher total scores indicated more health-related activities.

Measure: Change scores of International Physical Activity Questionnaires (IPAQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The upper limb subscale of the Fugl-Myer Assessment (FMA-UE) assesses the motor impairments of upper limbs after stroke. The FMA-UE contains 33 movements with a score range from 0 to 66. A higher score indicated better motor recovery in upper limbs.

Measure: Change scores of Fugl-Myer Assessment (FMA)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Rivermead Mobility Index (RMI) evaluates the participant's functional mobility, balance, gait and walking ability. It contains a 15-item scale which includes 14 questions and one direct observation, with a total of score of 15 and higher scores indicating better mobility performance.

Measure: Change scores of Rivermead Mobility Index (RMI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: We will evaluate isometric knee flexors and extensors muscle strength using handheld dynamometer. Also, we will use hand dynamometer to measure grip strength of the affected and less affected hand while the participant is seated, with the elbow at 90-degree flexion. We will record the mean value of 3 attempts.

Measure: Change scores of Muscle Strength

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The FIM assesses the dependence level of individuals with stroke to perform 18 activities (13 motor and five cognitive tasks) in daily living. The score ranges from 18 to 126 and higher scores demonstrate greater independent participation in daily activities (Ottenbacher, Hsu, Granger, & Fiedler, 1996). The FIM has good interrater reliability and validity (Hsueh, Lin, Jeng, & Hsieh, 2002).

Measure: Change scores of Functional Independence Measure (FIM)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Lawton IADL scale evaluates 8 activities with a score range from 0 to 8 (higher indicate better function). The inter-rater reliability and validity of the Lawton IADL have been established to be moderate to high for community-dwelling older adults (Graf, 2008; Lawton & Brody, 1969).

Measure: Change scores of Lawton Instrumental Activities of Daily Living Scale (Lawton IADL)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The SIS contains 59 items measuring eight domains, including strength, hand function, ADL/IADL, mobility, communication, emotion, memory/thinking, and participation, with a single item assessing perceived overall recovery from stroke. The total score is the average of the domain scores, and the domain scores are the averages of the item scores (1-5), and higher scores indicate better function or QOL.

Measure: Change scores of Stroke Impact Scale (SIS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The quality of life will be assessed by the EQ-5D questionnaire which comprises the following five dimensions: mobility, self-care, usual activities, pain/discomfort and anxiety/depression. Each dimension has three levels: no problems, some problems, extreme problems. The score has been shown to be reliable and valid (Greiner et al., 2003).

Measure: Change scores of EuroQol-5D Questionnaire (EQ-5D)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The social participation level will be assessed with the Community Integration Questionnaire (CIQ).It contains 15 items to evaluate the degree of integration into each of the three area of family, social network, and productive activities. The total scores range from 0 to 29 with larger numbers indicating better integration.

Measure: Change scores of Community Integration Questionnaire (CIQ)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Geriatric Depression Scale (GDS) - 15 items version is a self-administered questionnaire used to evaluate mood and depressive symptoms. The scores range is 0-15 and a score of 5 or greater taken as a possible indicator of depression.

Measure: Change scores of Geriatric Depression Scale (GDS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: The Task-based EEG will be collected when participants perform the n-back task before and after the intervention program to examine the effects of training on neural plasticity.

Measure: Task-based Electroencephalogram (EEG)

Time: Baseline, posttest (an expected average of 3 months)

Description: Saliva samples will be collected at baseline to determine the Brain-Derived Neurotrophic Factor (BDNF) val66met genotype.

Measure: BDNF val66met genotype

Time: Baseline

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include serum BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Serum BDNF will be quantified using an enzyme-linked immunosorbent assay (Human BDNF Quantitative Immunoassay, DBD00, R&D Systems) according to the manufacturer's instructions. This sandwich ELISA is set in order to measure natural and recombinant human mature BDNF in serum and plasma. All assays will be performed on F-bottom 96-well plates (Nunc, Wiesbaden, Germany).

Measure: Serum BDNF level

Time: Baseline, posttest (an expected average of 3 months)

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. Antioxidative markers will be used to reflect the changes on oxidative stress. In particular, we will be analyzing the total antioxidant capacity (TAC).

Measure: Total antioxidant capacity (TAC)

Time: Baseline, posttest (an expected average of 3 months)

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. HbA1C level will be tested to investigate the relationships between blood glucose level and aerobic exercise.

Measure: Glucose indicator

Time: Baseline, posttest (an expected average of 3 months)

Description: Blood samples will be collected at baseline and after the intervention programs. The blood tests will include BDNF level, antioxidative markers, HbA1C level, and Plasma lipid level. The cholesterol ratio (total cholesterol divided by high-density lipid) will be evaluated to reflect the lipid level in the blood.

Measure: Plasma lipid level

Time: Baseline, posttest (an expected average of 3 months)

Secondary Outcomes

Description: The Caregiver Strain Index (CSI) is a tool that can be used to quickly identify families with potential caregiving concerns. It is a 13-question tool that measures strain related to care provision. The reliability and validity has been established (Robinson, 1983).

Measure: Change scores of Caregiver Strain Index (CSI)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

Description: CBS evaluates the burden of the primary caregiver of the participants, including general strain, isolation, disappointment, emotional involvement, and environment of the caregivers. The CBS for caregivers of stroke patients showed moderate to good test-retest reliability and construct validity (Elmstahl, Malmberg, & Annerstedt, 1996).

Measure: Change scores of Caregiver Burden Scale(CBS)

Time: Baseline, posttest (an expected average of 3 months), follow-up (up to 9 months)

42 Cognitive Remediation and Supported Education in Psychotic Disorders: a Randomized Controlled Trial on the Efficacy and the Best Predictors of Academic Functioning

This trial aims to assess the added value of cognitive remediation therapy to supported education intervention in young adults with a psychotic disorder. The objectives of this study are threefold: The first objective is to evaluate the efficacy of supported education and cognitive remediation therapy for young adults with psychotic disorders in terms of academic outcome (primary outcome) and cognitive, neurobiological, and psychological outcomes (secondary outcomes). The second objective is to explore mechanisms of change in academic outcomes using a multidimensional approach (cognitive, psychological and biological characteristics) in youth with psychotic disorders. The third objective is to investigate the patients' perspectives regarding their appreciation of the supported education programs. Academic outcomes, cognitive performance as well as psychological and genetic variables will collected at baseline (T0). Participants will then be randomized either to the experimental condition (Cognitive remediation + Supported education + Treatment as usual) or the control condition (Supported education + Treatment as usual) for three months. Directly after the end of treatment (T1) and three months following the end of treatment (T2), the same measures as baseline will be repeated. One year post-treatment (T3), a last assessment will be conducted for academic outcomes.To assess qualitative experience of patients enrolled in supported education, we will recruit a subsample of the randomized controlled trial to participate in a photovoice activity.

NCT04040829 Psychotic Disorders Behavioral: Cognitive remediation therapy (CR) Behavioral: Supported education (SE) Other: Treatment as usual (TAU)
MeSH: Mental Disorders Psychotic Disorders
HPO: Psychosis

Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline. --- Val66Met ---

Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).. Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline. --- Val66Met ---

Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).. Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline. --- Val66Met --- --- Val66Met ---

Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).. Presence or absence of the Val158Met polymorphism on the Catechol-O-Methyltransferase (COMT) gene. --- Val66Met ---

Primary Outcomes

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. The School subscale assesses the ability to meet deadlines, punctuality and school performance.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (School subscale)

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree. Relationships and social activities at school subscale assesses relationships with professors and students as well as participation in class.

Measure: Mean change from baseline on the First-Episode Social Functioning Scale (Relationships and social activities at school subscale)

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Rubric tool assesses six domains of academic functioning, namely contributions, attitude, preparedness, focus on the task, professionalism and effort, and a composite score from those six scales. Based on the rating of several questions, a mean score of each domain, as well as a total score, will be obtained using a Likert scale that ranges from 1 (lowest the student can achieve) to 4 (highest the student can achieve).

Measure: Mean change from baseline on the Rubric tool

Time: Baseline (T0; moment of enrollment in the study) to 1-year post-treatment (T3; one year following the end of the intervention)

Secondary Outcomes

Description: The CVLT-II assesses verbal episodic memory. The test includes the learning of a list of words, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the California verbal learning test-II (CVLT-II) (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The CVLT-II assesses verbal episodic memory. The test includes the learning of a list of words, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the California verbal learning test-II (CVLT-II) (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Rey complex figure test assesses visual episodic memory. The test includes the copy of a complex figure, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the Rey Complex Figure test (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Rey complex figure test assesses visual episodic memory. The test includes the copy of a complex figure, followed by an immediate and a delayed recall.

Measure: Raw score change from baseline on the Rey Complex Figure test (delayed recall).

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The digit span subtest backward assesses verbal working memory. A series of number are read to the participant. The participant has to recall the numbers backward.

Measure: Raw score change from baseline on the digit span subtest backward of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The digit span subtest backward assesses verbal working memory. A series of number are read to the participant. The participant has to recall the numbers backward.

Measure: Raw score change from baseline on the digit span subtest backward of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The coding subtest assesses speed of processing. The participant has to match as many numbers as possible with symbols based on a key.

Measure: Raw score change from baseline on the coding subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The coding subtest assesses speed of processing. The participant has to match as many numbers as possible with symbols based on a key.

Measure: Raw score change from baseline on the coding subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The spatial span subtest backward assesses visual working memory. A board with blocks are presented to the participant. The assessor point series of blocks and the participant has to point the blocks backward.

Measure: Raw score change from baseline on the spatial span subtest backward of the Wechsler Memory Scale

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The spatial span subtest backward assesses visual working memory. A board with blocks are presented to the participant. The assessor point series of blocks and the participant has to point the blocks backward.

Measure: Raw score change from baseline on the spatial span subtest backward of the Wechsler Memory Scale

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The HRT-BC assesses sustained attention. Letters appear on a computer screen and the participant has to press the space bar as fast as possible, except when the letter is an "X". The HRT-BC reflects the reaction time between the six conditions of the CPT-3. In each condition, the letters are presented at a different rate. A higher HRT-BC score indicates a decrease of efficiency in information processing, which suggest difficulties in sustained attention.

Measure: Raw score change from baseline on the Hit Reaction Time Block Change (HRT-BC) of the Continuous Performance Test-3 (CPT-3)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The HRT-BC assesses sustained attention. Letters appear on a computer screen and the participant has to press the space bar as fast as possible, except when the letter is an "X". The HRT-BC reflects the reaction time between the six conditions of the CPT-3. In each condition, the letters are presented at a different rate. A higher HRT-BC score indicates a decrease of efficiency in information processing, which suggest difficulties in sustained attention.

Measure: Raw score change from baseline on the Hit Reaction Time Block Change (HRT-BC) of the Continuous Performance Test-3 (CPT-3)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The fourth condition of the Trail Making Test assesses cognitive flexibility. Letters and numbers are presented on a page.The participants has to connect these letters in alphabetical order and the numbers in numerical order while alternating between the numbers and letters

Measure: Raw score change from baseline on the fourth condition of the Trail Making Test (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The fourth condition of the Trail Making Test assesses cognitive flexibility. Letters and numbers are presented on a page.The participants has to connect these letters in alphabetical order and the numbers in numerical order while alternating between the numbers and letters

Measure: Raw score change from baseline on the fourth condition of the Trail Making Test (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The third condition of the color-word interference assesses inhibition. Name of color written in a different color of ink are presented to the participant. The participant has to name the color of the ink for each word as fast as possible.

Measure: Raw score change from baseline on the third condition of the color-word interference (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The third condition of the color-word interference assesses inhibition. Name of color written in a different color of ink are presented to the participant. The participant has to name the color of the ink for each word as fast as possible.

Measure: Raw score change from baseline on the third condition of the color-word interference (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The first condition of the verbal fluency subtest assesses phonemic fluency. The participant has to name as many word as possible in one minute that start by a given letter.

Measure: Raw score change from baseline on the verbal fluency subtest (first condition) (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The first condition of the verbal fluency subtest assesses phonemic fluency. The participant has to name as many word as possible in one minute that start by a given letter.

Measure: Raw score change from baseline on the verbal fluency subtest (first condition) (Delis-Kaplan Executive Function System; D-KEFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Tower of London assesses planning and organization. For this test, the assessor produces different models on his board using three beads (green, blue and red). The participant has to replicate the model using as few moves as possible.

Measure: Raw score change from baseline on the Tower of London (total item completed with the minimum movement)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Tower of London assesses planning and organization. For this test, the assessor produces different models on his board using three beads (green, blue and red). The participant has to replicate the model using as few moves as possible.

Measure: Raw score change from baseline on the Tower of London (total item completed with the minimum movement)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Matrix reasoning subtest assesses perceptual reasoning. Series of complex patterns are presented to the participant. The participant has to choose the logical end to each pattern.

Measure: Raw score change from baseline on the Matrix subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Matrix reasoning subtest assesses perceptual reasoning. Series of complex patterns are presented to the participant. The participant has to choose the logical end to each pattern.

Measure: Raw score change from baseline on the Matrix subtest of the Wechsler Adult Intelligence Scale-IV (WAIS-IV)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Combined stories test assesses theory of mind. Short stories are presented to the participant and questions regarding the mental states of the characters are asked.

Measure: Raw score change from baseline on the Combined Stories test

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Combined stories test assesses theory of mind. Short stories are presented to the participant and questions regarding the mental states of the characters are asked.

Measure: Raw score change from baseline on the Combined Stories test

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Social Knowledge test assess social perception. Situations of daily life are presented to the participant. The participant is asked to state the emotion that would be felt by most people in that situation.

Measure: Raw score change from baseline on the Social Knowledge test

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Social Knowledge test assess social perception. Situations of daily life are presented to the participant. The participant is asked to state the emotion that would be felt by most people in that situation.

Measure: Raw score change from baseline on the Social Knowledge test

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Penn Emotion Recognition task assesses emotion recognition. Faces expressing emotions are presented on a computer screen. The participant has to determine the emotion expressed by the character among the seven choices.

Measure: Raw score change from baseline on the Penn Emotion Recognition task

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Penn Emotion Recognition task assesses emotion recognition. Faces expressing emotions are presented on a computer screen. The participant has to determine the emotion expressed by the character among the seven choices.

Measure: Raw score change from baseline on the Penn Emotion Recognition task

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The Échelle de Répercussion Fonctionnelle assesses functional impact of cognitive deficits in daily living using a semi-structured interview. The severity of the functional impact is rated on a Likert scale from 1= no impact to 7=important impact.

Measure: Raw score change from baseline on the Échelle de Répercussion Fonctionnelle

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The Échelle de Répercussion Fonctionnelle assesses functional impact of cognitive deficits in daily living using a semi-structured interview. The severity of the functional impact is rated on a Likert scale from 1= no impact to 7=important impact.

Measure: Raw score change from baseline on the Échelle de Répercussion Fonctionnelle

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The PANSS is a semi-structured interview that assess clinical symptoms of psychotic disorder, including positive symptoms, negative symptoms and general psychopathology.

Measure: Raw score change from baseline on the Positive And Negative Syndrome Scale (PANSS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The PANSS is a semi-structured interview that assess clinical symptoms of psychotic disorder, including positive symptoms, negative symptoms and general psychopathology.

Measure: Raw score change from baseline on the Positive And Negative Syndrome Scale (PANSS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The SERS assesses self-esteem. The questionnaire includes 20 questions rated on a Likert scale from 1=Never to 7=Always

Measure: Raw score change from baseline on the Self-Esteem Rating Scale (SERS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The SERS assesses self-esteem. The questionnaire includes 20 questions rated on a Likert scale from 1=Never to 7=Always

Measure: Raw score change from baseline on the Self-Esteem Rating Scale (SERS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The SSTICS assesses metacognitive knowledge, i.e., participant' perceptions of his cognitive abilities. The questionnaire includes 21 questions rated on a Likert scale ranging from 0=Never to 4=very often.

Measure: Raw score change from baseline on the Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The SSTICS assesses metacognitive knowledge, i.e., participant' perceptions of his cognitive abilities. The questionnaire includes 21 questions rated on a Likert scale ranging from 0=Never to 4=very often.

Measure: Raw score change from baseline on the Subjective Scale to Investigate Cognition in Schizophrenia (SSTICS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree

Measure: Raw score change from baseline on the First-Episode Social Functioning Scale (FESFS)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The FESFS assesses different aspect of functioning including social functioning, productive activities and instrumental activities of daily living. Each question is rated on a Likert scale ranging from 1=Totally disagree to 4= Completely agree

Measure: Raw score change from baseline on the First-Episode Social Functioning Scale (FESFS)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: The CTQ assesses adverse events experienced during childhood and adolescence. The CTQ includes 70 items rated on a Likert scale ranging from 1=Never true to 5=very often true

Measure: Raw score change from baseline on the Childhood Trauma Questionnaire (CTQ)

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: The CTQ assesses adverse events experienced during childhood and adolescence. The CTQ includes 70 items rated on a Likert scale ranging from 1=Never true to 5=very often true

Measure: Raw score change from baseline on the Childhood Trauma Questionnaire (CTQ)

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).

Measure: Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: Presence or absence of a genetic variant (Met66Met) of the BDNF gene (Val66Met).

Measure: Presence or absence of a genetic variant (Met66Met) of the Brain-derived neurotrophic factor (BDNF) gene (Val66Met) at baseline

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

Description: Single nucleotide polymorphisms (SNP) in the 3' end of the COMT gene and the Val158Met polymorphism

Measure: Presence or absence of the Val158Met polymorphism on the Catechol-O-Methyltransferase (COMT) gene

Time: Baseline (T0; moment of enrollment in the study) to Post-treatment (T1; directly after the 3-months period of intervention)

Description: Single nucleotide polymorphisms (SNP) in the 3' end of the COMT gene and the Val158Met polymorphism

Measure: Presence or absence of the Val158Met polymorphism on the Catechol-O-Methyltransferase (COMT) gene

Time: Baseline (T0; moment of enrollment in the study) to 3-months post-treatment (T2; three months following the end of the intervention)

43 Effect of High Intensity Interval Training on Mechanisms of Neuroplasticity and Psychomotor Behaviours in Parkinson's Disease Patients: a Randomized Study With 1-year Follow up

There are experimental evidences of the important role of high intensity physical exercise in Parkinson's disease (PD) treatment, that induces similar effects to pharmacotherapy. So far, the mechanisms of the impact of these changes on the brain subcortical and cortical regions functioning, motor activities and cognitive functions are still not clear. The aim of this longitudinal (prospective) human experiment is to examine the effects of two cycles of 12-weeks high-intensity interval training (HIIT) on: (i) the level of dopamine (DA) in putamen in striatum, (ii) neurophysiological function of subcortical and cortical motor structures and skeletal muscle activity, (iii) psychomotor behaviors critically associated with dopamine dependent neural structures functioning and (iv) neurotrophic factors' secretion level in blood. The investigators will recruit 40 PD individuals, who will be divided into two groups: one of them will perform two 12-weeks cycles of HIIT (PD-TR), and the other will not be trained (PD-NTR) with HIIT. The investigators will also recruit 20 age-matched healthy controls (H-CO) as additional control group who will not perform the HIIT. The PD-TR group will perform the two 12-weeks cycles of the HIIT, that induces beneficial, neuroplastic changes and alleviates the PD symptoms, what was found in earlier studies. All PD subjects (PD-TR and PD-NTR) will be examined during their medication "OFF-phase" (it means after dopaminergic drugs withdrawal) before (Pre) and after (Post) training cycles (first training cycle - HIIT 1; second training cycle - HIIT 2), and namely: Pre HIIT 1, 1 week-, 1.5 month- and 3 months-Post HIIT 1; and then similarly 1 week-, 1.5 month- and 3 months-Post HIIT 2. The subject from H-CO will be tested only once. To examine the assumed HIIT-induced changes in brain functioning the investigators will apply: (i) the positron emission tomography (PET), (ii) the functional magnetic resonance imaging (fMRI), (iii) electroencephalography (EEG) and (iv) an analysis of neurotrophic factors secretion level in blood. The investigators will also assess motor and non-motor symptoms of PD and psychomotor behaviors based on neuropsychological tests of cognitive functions and manual dexterity. The results of this project will help to answer the fundamental questions about HIIT induced mechanisms of neuroplasticity in PD patients, what is important from scientific and treatment-strategy point of view.

NCT04204551 Parkinson's Disease Physical Activity Neurorehabilitation Neuroplasticity Behavioral: high-intensity interval training (HIIT) Behavioral: conventional physical therapy
MeSH: Parkinson Disease

Val66Met polymorphism of BDNF - genotyping of BDNF polymorphism. --- Val66Met ---

The single nucleotide polymorphism (SNP) BDNF Val66Met variant (rs 6265) will be genotyped by using the TaqMan SNP genotyping assay. --- Val66Met ---

The PD patients neuroplastic responsiveness to HIIT will be influenced by the BDNF polymorphism type, with potentially worse responsiveness for the Val66Met polymorphism of BDNF (this polymorphism causes a valine to methionine change at position 66 of the proBDNF protein). --- Val66Met ---

The investigators hypothesize that, the HIIT related increase of presynaptic DA availability will be significantly positively correlated with: (i) an improvement of NPFs and PMBs, and with an increased level of BDNF secretion in blood, and (ii) negatively with the BDNF Val66Met polymorphism type in PD-TR group. --- Val66Met ---

Primary Outcomes

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: 1-week Post-HIIT 1

Description: To examine presynaptic striatal DA availability (in dorsal putamen) using PET imaging method with the 18F-dopa - [18F]fluorodopa uptake. The recordings will be expressed in Ki ref values [Ki ref] and Standard Uptake Values [SUV].

Measure: Positron Emission Tomography (PET) with 18F-dopa - PET imaging with [18F]fluorodopa uptake.

Time: 3-months Post-HIIT 2

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: 1-week Post-HIIT 1

Description: To evaluate neurophysiological functions of brain subcortical and cortical structures using MRI scanner. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The image recordings will express metabolic brain activity as expressed in fMRI response [% BOLD signal].

Measure: functional Magnetic Resonance Imaging (fMRI) - metabolic activity of brain recorded with MRI scanner.

Time: 3-months Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as an amplitude of event related potentials and expressed in microvolts [µV].

Measure: Electroencephalography (EEG) - amplitude of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as a latency of event related potentials and expressed in milliseconds [ms].

Measure: Electroencephalography (EEG) - latency of EEG event related potentials of brain cortex recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 1

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1-week Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 1.5-month Post-HIIT 2

Description: To evaluate neurophysiological functions of brain cortical structures, electroencephalography (EEG - electrical activity of brain cortex) will be recorded from scalp using 128-chanel system. The recordings will be conducted at rest and during self initiated index finger motor task and during mental imagery of this motor task. The recordings will be analyzed as the EEG power in the beta-band (≈13-35 Hz) and expressed in decibels [dB].

Measure: Electroencephalography (EEG) - EEG power in the beta-band recorded from scalp using surface electrodes.

Time: 3-months Post-HIIT 2

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1-week Post-HIIT 1

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1.5-month Post-HIIT 1

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 3-months Post-HIIT 1

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1-week Post-HIIT 2

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 1.5-month Post-HIIT 2

Description: To evaluate neurophysiological functions of muscles engaged in an activity (hand muscles), electromyography (EMG - recordings of electrical activity of skeletal muscles) will be collected using surface electrodes, during index finger motor tasks and at rest. The recordings will be expressed in millivolts [mV].

Measure: Electromyography (EMG) - recordings of electrical activity of skeletal muscles using surface electrodes.

Time: 3-months Post-HIIT 2

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1-week Post-HIIT 1

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1.5-month Post-HIIT 1

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 3-months Post-HIIT 1

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1-week Post-HIIT 2

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 1.5-month Post-HIIT 2

Description: To evaluate executive function and bimanual dexterity. The Purdue Pegboard consists of a test board, score sheets and elements to work with: pins, collars, washers. Subjects are instructed to insert pins to holes in the board or build the sets with the elements in a fixed time. The final score is the number of pins inserted or built sets [number of pins or sets].

Measure: Purdue Pegboard Test (PPT) - neuropsychological test

Time: 3-months Post-HIIT 2

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1-week Post-HIIT 1

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1.5-month Post-HIIT 1

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 3-months Post-HIIT 1

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1-week Post-HIIT 2

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 1.5-month Post-HIIT 2

Description: TMT-A is a psychological measure of cognitive processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-A - trail making test, part A

Time: 3-months Post-HIIT 2

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT1 starts

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1-week Post-HIIT 1

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1.5-month Post-HIIT 1

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 3-months Post-HIIT 1

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1-week Post-HIIT 2

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 1.5-month Post-HIIT 2

Description: TMT-B is a psychological measure of executive function, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: TMT-B - trail making test, part B

Time: 3-months Post-HIIT 2

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1-week Post-HIIT 1

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1.5-month Post-HIIT 1

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 3-months Post-HIIT 1

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1-week Post-HIIT 2

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 1.5-month Post-HIIT 2

Description: ST-I is used as a psychological measure of processing speed, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-I - Stroop Test, part I

Time: 3-months Post-HIIT 2

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1-week Post-HIIT 1

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1.5-month Post-HIIT 1

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 3-months Post-HIIT 1

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1-week Post-HIIT 2

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 1.5-month Post-HIIT 2

Description: ST-II is used as a psychological measure of selective attention and inhibition, measured as performance time (the shorter the time the better performance), expressed in [s].

Measure: ST-II - Stroop Test, part II

Time: 3-months Post-HIIT 2

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1-week Post-HIIT 1

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1.5-month Post-HIIT 1

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 3-months Post-HIIT 1

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1-week Post-HIIT 2

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 1.5-month Post-HIIT 2

Description: Motor and non-motor Parkinson's disease signs/symptoms will be evaluated using UPDRS (sections I - III, that include the items 1 -31). Each item is expressed in [points] from 0 to 4 points, with an interpretation that the higher value means the severe accentuation of sign/symptom. The total score will be reported, as the sum of the points of the sections I-III (the score in the range 0 - 176 points) and each section's score will be reported as well, i.e.: the sum of the points of the section I (sum of points for items 1-4 in the range 0 - 16 points), the sum of the points of the section II (sum of points for items 5-17 in the range 0 - 52 points), the sum of the points of the section III (sum of points for items 18-31 in the range 0 - 108 points).

Measure: UPDRS - unified Parkinson's disease rating scale

Time: 3-months Post-HIIT 2

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1-week Post-HIIT 1

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1.5-month Post-HIIT 1

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 3-months Post-HIIT 1

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1-week Post-HIIT 2

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 1.5-month Post-HIIT 2

Description: BDNF secretion level in blood expressed in [pg/mL]

Measure: BDNF - brain derived neurotrophic factor

Time: 3-months Post-HIIT 2

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1-week Post-HIIT 1

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1.5-month Post-HIIT 1

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 3-months Post-HIIT 1

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1-week Post-HIIT 2

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 1.5-month Post-HIIT 2

Description: NGF secretion level in blood expressed in [pg/mL]

Measure: NGF - nerve growth factor

Time: 3-months Post-HIIT 2

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1-week Post-HIIT 1

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1.5-month Post-HIIT 1

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 3-months Post-HIIT 1

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1-week Post-HIIT 2

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 1.5-month Post-HIIT 2

Description: IGF 1 secretion level in blood expressed in [pg/mL]

Measure: IGF 1 - insulin-like growth factor 1

Time: 3-months Post-HIIT 2

Description: The single nucleotide polymorphism (SNP) BDNF Val66Met variant (rs 6265) will be genotyped by using the TaqMan SNP genotyping assay. Thermal cycling and end-point PCR (polymerase chain reaction) analysis will be performed on the Rotor-Gene Q 5plex real-time PCR Cycler and will be analyzed by Q-Rex-software. Genotype of BDNF polymorphism will be expressed in percentge values [% of genotype].

Measure: Val66Met polymorphism of BDNF - genotyping of BDNF polymorphism

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Secondary Outcomes

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1-week Post-HIIT 1

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1.5-month Post-HIIT 1

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 3-months Post-HIIT 1

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1-week Post-HIIT 2

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 1.5-month Post-HIIT 2

Description: Parkinson's disease stage evaluation using H&Y scale, expressed in [points] from 1 to 5 points. The modified version of the H&Y scale will be used, in which: the score 1 means - unilateral involvement only; the score 1.5 means - unilateral and axial involvement; the score 2 means - bilateral involvement without impairment of balance; the score 2.5 means - mild bilateral disease with recovery on pull test; the score 3 means - mild to moderate bilateral disease, some postural instability, physically independent; the score 4 means - severe disability, still able to walk or stand unassisted; the score 5 means - wheelchair bound or bedridden unless aided.

Measure: H&Y scale - Hoehn and Yahr scale

Time: 3-months Post-HIIT 2

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1-week Post-HIIT 1

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1.5-month Post-HIIT 1

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 3-months Post-HIIT 1

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1-week Post-HIIT 2

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 1.5-month Post-HIIT 2

Description: S&E DLA scale measure of daily function of Parkinson's disease patients, expressed in [%] from 100 to 0 % (with the higher % value as the better score). The 100% score means that the person is completely independent; able to do all chores without slowness, difficulty or impairment; essentially normal; unaware of any difficulty. The 0% score describes the person bedridden with the only vegetative functions such as swallowing; bladder and bowel functions are not functioning.

Measure: S&E DLA scale - Schwab and England Daily Living Activity Scale

Time: 3-months Post-HIIT 2

Description: MMSE will be used to to exclude the Parkinson's disease patients with cognitive impairment, expressed in [points]in the range from 0 to 30 points. It is an 11-question measure that tests five areas of cognitive function: orientation, registration, attention and calculation, recall, and language. A score of 23 or lower is indicative of cognitive impairment.

Measure: MMSE - Mini Mental State Examination

Time: Pre-HIIT 1 - it means up to 1-week before the HIIT 1 starts

44 Epigenetic Regulation of Brain-Derived Neurotrophic Factor (BDNF) Gene Expression According to Response to Cognitive Remediation in Schizophrenia

This study is a randomised and controlled trial that aims to investigate whether Cognitive Remediation Therapy (CRT) can modulate epigenetic mechanisms by changing methylation levels of BDNF gene in patients with Schizophrenia.

NCT04278027 Schizophrenia Behavioral: Cognitive Remediation Therapy
MeSH: Schizophrenia
HPO: Schizophrenia

It also aims to test whether BDNF valine-66-methionine (Val66Met) polymorphism influences CRT treatment outcome among people with schizophrenia. --- valine-66-methionine ---

It also aims to test whether BDNF valine-66-methionine (Val66Met) polymorphism influences CRT treatment outcome among people with schizophrenia. --- valine-66-methionine --- --- Val66Met ---

Primary Outcomes

Description: Mean methylation percentage in CpG island BDNF CpG exon I: located at chr11:27743473-27744564 in the BDNF

Measure: Change in methylation at Cytosine-phosphate-Guanine (CpG) exon

Time: Baseline and after 4 months

Description: Mean methylation percentage of CpG region BDNF CpG exon IV: located at chr11:27723060-27723294 in exon IV, upstream of the start codon in exon VII

Measure: Change in methylation at CpG exon IV

Time: Baseline and after 4 months

Secondary Outcomes

Description: Total score in Measurement and Treatment Research to Improve Cognition in Schizophrenia (MATRICS) Consensus Cognitive Battery

Measure: Change in cognition

Time: Baseline and after 4 months

Description: Total score in Positive and Negative Syndromes Scale (PANSS)

Measure: Change in Symptoms

Time: Baseline and after 4 months


HPO Nodes


Stroke
Genes 165
NAGS GDF2 MPL VHL GTF2I CST3 FBN1 SON BAZ1B SLC2A10 MAT2A PRKAG2 TREX1 ND1 SNAP29 TRNH COL4A1 TRNS2 ACAD9 TRNS1 CRELD1 ACVRL1 DPM3 GUCY1A1 CPS1 ND4 GNAQ LMNA RFC2 FOXE3 APP SMAD4 TGFBR2 TPP2 COL4A1 TRNK TRNL1 PRNP GATA4 HBB MYH11 COX2 HTRA1 SLC19A2 ENG TGFB3 PCNT CCM2 PIGA MMUT TRNQ TRNQ MPL MPL GTF2IRD1 SMAD4 TRNS2 ND6 PMM2 MYH11 SMAD4 GYS1 PRKCH ANGPTL6 SCN5A XYLT2 HSD11B2 ACTG1 TRNS1 CBS LIMK1 APP MFAP5 GUCY1A1 DYRK1B MTHFR TRNV SH2B3 COX3 MYH11 ALOX5AP NOS3 ENG NR2F2 TRNL1 ADA2 COX1 SLC19A2 MYD88 GLA JAG1 MLXIPL TP53 TRNW CLIP2 TRNC KRAS TRNF TET2 NOTCH3 ADA2 ND1 NR3C1 GATA6 NPPA ELN RFT1 SMARCAL1 AGXT FLNA TRNW COX3 JAK2 CYP11B1 CYTB F2 SMAD3 APP ACTA2 TNXB OTC APP COL3A1 TET2 ZMPSTE24 PRKG1 MYLK ASS1 TBL2 COX2 WFS1 THPO ELN PIK3C2A CALR JAK2 ENG TGFBR3 TGFB2 ND5 TTR F5 ND6 MECP2 ELN GLA ACTB ACVRL1 COX1 MYBPC3 APP TREX1 ND5 CST3 KCNQ1 COL3A1 ABCC6 ZAP70 TRNF HTRA1 LOX XYLT1 STIM1 JAK2 TGFBR1
Mental deterioration
Genes 462
TIMM8A PRNP GRN SCN9A CSF1R WDR45 RNASEH1 PRKAR1A CHMP2B SCN1A SLC6A1 CYP27A1 ATP1A3 DNAJC13 ND1 OPA1 SNCA QDPR TRNS1 APOL4 CTC1 SNORD118 DRD3 ADH1C PARS2 APOE TYMP GABRB3 BSCL2 CPLX1 FUS LMNB1 ERCC4 GABRA2 AP5Z1 COX2 SCN1A TIMMDC1 SNCA YWHAG TRNQ IRF6 UBA5 GBA DNMT1 PSAP HNRNPA1 APOL2 SCN3A DNAJC6 DNMT1 PDE11A SYN2 ITM2B RAB27A HTT SUMF1 ATP6V1E1 GABRG2 SDHA COX3 GBA2 HEXB WFS1 TYROBP C9ORF72 RRM2B NPC2 SURF1 PNPLA6 NHLRC1 DAOA ERCC6 SCARB2 C9ORF72 CNTNAP2 UBTF HTT RNF216 PDGFRB UCHL1 PRNP HNRNPA2B1 LRRK2 NDUFS2 CYTB MFSD8 TINF2 APP APP CLN3 ATP13A2 PSEN1 ASAH1 ATXN3 SNCAIP BSCL2 DCAF17 NOTCH3 STXBP1 GBE1 AP2M1 GALC ATP6 IDUA HSD17B10 PPT1 JPH3 PSEN1 TTR PODXL PSEN1 APP COX1 PRNP APP COASY CTSD SPG11 GRN PRNP ATP13A2 POLG DCTN1 CHMP2B PPP2R2B SDHAF1 HEXA CST3 TWNK ATP6V0A2 GRN XPA TMEM106B SNCA CSF1R MATR3 PRNP MAPT CHMP2B AMN MAPT ERCC2 COL18A1 APP MAPT CSTB TRNK C19ORF12 MTHFR PSEN1 CP UBQLN2 TREM2 CLN8 PRKN CACNA1B ARSA NR4A2 ATN1 PRDM8 VCP RBM28 PSEN1 FA2H PINK1 PLAU TRPM7 CFAP43 HFE VCP GBA NDUFB8 ATP7B NDUFA6 XPR1 TUBA4A TRAK1 AKT1 SYNGAP1 CHD2 HNRNPA2B1 CERS1 AARS2 CTSF TBP SYNJ1 SERPINI1 MATR3 TRNL1 WWOX GABRB2 MAPT PSAP ABCA7 KCNA2 TRNC ALDH18A1 NOTCH3 MAPK10 PLP1 GRN FTL CHCHD10 TMEM106B TTPA VCP C9ORF72 TIMM8A NUS1 FGF12 PSEN2 FBXO7 LRRK2 HIBCH EEF1A2 PANK2 CUX2 FMR1 PRKAR1B PDGFRB NTRK2 CHI3L1 ND5 MAPT EIF4G1 HEPACAM VPS35 SPG21 GNAS TREX1 CLTC ALDH18A1 EPM2A PDGFRB CHD2 SYNJ1 GBA PRDX1 ATXN2 PRICKLE1 DHDDS RTN4R SLC13A5 ZFYVE26 NRAS POLG SCN8A HNF1A KCNA2 TREM2 TBP HTR2A SQSTM1 WFS1 TREM2 CLN8 PLA2G6 SPAST PRKCG NDUFAF3 RNF216 CLN6 PLA2G6 GDAP2 GBA PSEN1 SUMF1 HTRA1 TARDBP NDP PINK1 MFN2 NECAP1 NHLRC1 VPS13C ATXN7 ND6 PANK2 PSAP GLUD2 PTS GCH1 LRRK2 MECP2 NOS3 FA2H SQSTM1 ATXN2 ARSA TRNK SQSTM1 MAPT GRN APP RBM28 NOTCH2NLC PDGFB TBC1D24 PDE10A KCTD7 TRNV MAPT ACTB MAPT RAB39B TREM2 ROGDI SNCA SLC20A2 MAPT ABCC8 CTNS TARDBP CYFIP2 GRIN2D CLN6 WDR45 DNM1 HLA-DQB1 ATP1A2 UBAP1 TRNW NPC1 ATP6 GLB1 GBA2 TRNE TMEM106B MAPT PDGFB GBA SNCA JPH3 SMC1A MAPT C9ORF72 PARK7 NAGLU APTX MYORG SDHD DNM1L SLC1A2 ROGDI PRDM8 C19ORF12 MAPT ATXN10 PLEKHG4 HTRA2 DARS2 HGSNAT COL4A1 SLC2A3 ATP13A2 MBTPS2 TRNF CUBN FMR1 NBN TLR3 TUBB4A GBA SLC13A5 TK2 SGPL1 AARS1 TREX1 TRNS2 KCNC1 SNCB VPS13C ATP6V1A AP3B2 VCP RRM2B UCP2 DCTN1 GM2A SORL1 PRNP PRNP MAPT ABCD1 ARV1 PLA2G6 TBK1 HTT DNAJC5 DGUOK ARSA ATP13A2 CHMP2B CSTB SPG11 PSEN2 PSEN1 CISD2 CHCHD10 MPO ATXN7 ITM2B FTL HCN1 CACNA1A MCOLN1 PAH SPG21 KMT2A PPP2R2B ADA2 TREM2 TBK1 CHMP2B TYROBP EPM2A VPS13A ATXN8OS HNF4A SCO2 GABRA5 PPP3CA ATXN2 TOMM40 GIGYF2 PRNP APOE SZT2 COMT SDHB ADA2 SQSTM1 ACTL6B ST3GAL5 CNKSR2 FA2H C9ORF72 KCNJ11 CLN5 SYNJ1 TBP KCNB1 CFAP43 APP ATP6V1A ERCC8 GBA VCP DNMT1 DNM1 MMACHC A2M CP HTRA1 TBK1 ASAH1 DISC2 ATN1 RRM2B SNCA VCP
Schizophrenia
Genes 71
USH1C RTN4R USH1G HIRA UPF3B GJA5 DNAJC13 DNMT3A KRT86 HTR2A APOL4 CLRN1 DRD3 CEP78 ARSG MSTO1 TRNE PRODH RREB1 GIGYF2 PDZD7 MTHFR RBM12 ADGRV1 NKX2-1 TRNS2 KRT83 SNCA MYO7A COMT CIB2 PCDH15 WHRN TBX1 GP1BB DSG4 ZDHHC9 ARSA ARVCF WFS1 PRODH PSAP APOL2 SEC24C KRT81 LRRK2 CHI3L1 MYO7A ATP2A2 SHANK3 SYN2 EIF4G1 CHRNA7 GBA FLI1 MED12 VPS35 JMJD1C MSTO1 USH2A AKT1 GJA8 TBX1 COMT UFD1 PRODH DISC2 TBX1 HARS1 CDH23 DAOA
Depressivity
Genes 377
AMACR BAZ1B PDCD1 PRKAR1A KCTD17 AFG3L2 DNAJC13 NSMF PRPH TBP DNA2 TOR1A UBQLN2 MED25 WFS1 TRNL1 ADH1C ND4 GNAS RFC2 FGF14 HMBS PLA2G6 SPAST PRKCG HTR2A SQSTM1 ATRX GABRA1 FGF8 FUS CLCN4 LMNB1 CLN6 TRNS2 GDAP2 PON2 GSN SNCA FAN1 XK TWNK PTS TRNQ RPS6KA3 TBX1 GLT8D1 OPTN PINK1 GTF2IRD1 NHLRC1 GBA TRNN PANK2 CRBN GNRH1 PSAP NDST1 GLUD2 SOD1 DNAJC6 LRRK2 DNMT1 PDE11A TAC3 DRD2 MAN1B1 HTT AP2S1 SPRY4 PGAP1 CBS SQSTM1 TOR1A AIMP1 TUSC3 PDGFB TWNK FMO3 SLC20A2 MECP2 CACNA1G CDH23 C9ORF72 FUS GPR35 TARDBP C9ORF72 HIRA IDUA HLA-DQB1 PRSS12 C9ORF72 CLIP2 PIGC HNMT JRK TRNF PAH CLRN1 ATXN2 CPOX CEP78 MSTO1 ELN CLCN4 CISD2 PROK2 PDGFB SGCE SLC6A4 KCNT1 PDGFRB UCHL1 MATR3 GABRG2 SMPD1 PRNP GNRHR KISS1R COQ2 HS6ST1 TNIK NEFH MAPT C9ORF72 ATP13A2 PARK7 NSUN2 SLC25A4 CCNF ANXA11 HLA-DQB1 TBL2 CPOX SNCAIP FIG4 TARDBP NOTCH3 LINS1 VAPB BMPR1A ARVCF SLC18A2 C19ORF12 MAPT ATXN10 POLG SLC45A1 KDM5B MST1 SEC24C B3GALNT2 MLH3 PPT1 FRRS1L JPH3 WDR11 PODXL ND6 ARMC5 HTRA2 AIP CRADD TTC19 MED23 ZC3H14 JMJD1C PRNP USH2A ATP1A3 TRNS1 ND5 EDC3 COASY UNC13A COMT UFD1 VCP POLG FMR1 PMS1 FMN2 PRNP PRNP CHD7 DCPS METTL23 DCTN1 TRNL2 GBA PPP2R2B ATP7B GTF2I USH1G PTPN22 SRPX2 TACR3 TWNK GNA11 TMEM106B SNCA CSF1R MLH1 TRNH PMS2 CLIP1 POLG2 ATXN8OS CASR VPS13C PON1 RSRC1 PPOX VCP HLA-DRB1 EZR DUSP6 BCS1L DCTN1 EHMT1 TRNL1 PRNP PDZD7 MSH6 MAPT EPHA4 POLG THOC2 CRKL CYP27A1 PLA2G6 ANG CC2D1A DCTN1 MYO7A CACNA1H HTT DNAJC5 COQ2 GRIN2A GP1BB DGUOK PRKN CHMP2B KRAS ARSA NR4A2 HNRNPA1 CHMP2B WASHC4 TRNS2 ATXN10 MSH2 CFAP410 PFN1 HMBS CACNA1G GNAS MYO7A SLC2A1 PINK1 POLG C9ORF72 PSEN1 ANOS1 PIK3CA ALMS1 TBC1D7 VCP TRNS1 PANK2 GBA TK2 LIMK1 CHCHD10 XPR1 PPARGC1A RPS20 USP8 ST3GAL3 ARMC5 HARS1 KCTD17 TAF15 AARS2 PER3 FGF14 CTSF TBP MECP2 MBOAT7 POLG PAH TREM2 USH1C TREM2 COX1 TBK1 C12ORF4 WARS2 STX16 ATXN8 SGCE ND1 ATXN8OS PRKACA TBK1 ARSG MAPK1 ATXN2 GRN ABCA7 OCRL KCNJ2 TRNW CHCHD10 COX3 RREB1 DAO GIGYF2 GPR101 TECR CDH23 ATP1A3 EPCAM ADGRV1 GNAS TCF4 GNAS GABRG2 PRNP KISS1 TGFBR2 SEMA4A TWNK GCH1 CIB2 COX2 FGFR1 PCDH15 WHRN LRRK2 TRAPPC9 RRM2B FMR1 RRM2B WFS1 FA2H FGF17 HBB PDGFRB SARS1 BCR EIF4G1 POLG ERBB4 GLA PER2 FBXO31 PON3 GLE1 PROKR2 VPS35 NEK1 MSTO1 LMAN2L GNAS DNMT1 GABRB3 CP TBX1 EPM2A PDGFRB GRIK2 SNCA VCP
Limb dystonia
Genes 32
CYB5A ANO3 THAP1 HPCA PRKRA VPS13C CKAP2L AFG3L2 PARK7 COL4A1 ARX TH SLC18A2 ARX VPS37A PANK2 PRKRA TH GNAL SLC6A3 BSCL2 TUBB4A ATP1A3 MAPT TAF1 GNAL PNPT1 CYB5R3 COL6A3 DDC THAP1 GCH1
Mania
Genes 29
TWNK RPS6KA3 TBX1 GP1BB HIRA RRM2B ARVCF FA2H SEC24C DNMT3A ATP2A2 MECP2 POLG2 CLCN4 CHRNA7 FLI1 JMJD1C SMPD1 RREB1 USP8 CDH23 SLC25A13 CLCN4 TBX1 COMT POLG UFD1 TBX1 SLC25A4
Dysmenorrhea
Genes 16
PPARG LMNA FOS CYB5A CAVIN1 ANTXR1 INHBA CYP17A1 GPR101 PPARG CAV1 LMNA AGPAT2 CYP17A1 BSCL2 AIP
Writer's cramp
Genes 20
CASR KCNA1 SGCE FTL COL6A3 TBP THAP1 PRRT2 TOR1A GNA11 TBC1D24 HINT1 COL6A3 TOR1A TBC1D24 KCTD17 CIZ1 SGCE DRD2 GCH1
Cerebral hemorrhage
Genes 67
CPT2 GDF2 VHL PDCD10 CST3 SH2B3 F13A1 COLGALT1 SMARCB1 COL4A1 SDHAF2 ACVRL1 NF2 APP SDHD MAX CFI TMEM127 TGFB3 APP JAK2 SLC25A11 APP CD46 PROS1 ENG KIF1B MAX CCM2 VHL PDGFB NDE1 USP18 KRIT1 FCGR2C RET SMAD4 CCM2 PDCD10 SDHC FH JAK2 SUFU FGG FN1 TMEM127 GDNF ACVRL1 HELLPAR ABCC6 SDHA FGA APP KIF1B SDHD VHL APP CST3 CFH DLST RET FGB MDH2 SDHB SDHB F13B ENG
Non-Hodgkin lymphoma
Genes 32
ATM FAS CASP10 CTLA4 FAS BCL10 CD28 BIRC3 FOXP1 TNFRSF1B MYC CCND1 ASXL1 ATM MALT1 CTLA4 CD28 SRSF2 KIT POLE IGH ADA TET2 FASLG PIK3R1 NTHL1 RASGRP1 TNFRSF1B PRKCD NBN RHOH IGH
Inflammatory abnormality of the skin
Genes 454
TGM5 GTF2H5 TGM1 IL17RA MSN FERMT3 CTSC MBTPS2 ERCC2 BTK NFKB1 SPINK5 ERCC4 B2M TP63 KRT5 CASP10 NLRP3 MCCC2 LMBRD1 LYZ STAT3 GINS1 RFX5 KIT HYOU1 TP63 FLG DHCR7 TGFB1 KRT1 PEPD MBTPS2 TRPM1 WAS KDSR CIB1 ENPP1 PSTPIP1 SH3PXD2B HPGD NOD2 ALOX12B CERS3 TNFAIP3 ZNF750 RFXAP MS4A2 TBX1 CACNA1G IFIH1 SPINK5 SLC6A19 ERCC5 HIRA WNT4 SLCO2A1 BRAF WNT4 CD3G EDARADD CYBA CSTA DOCK8 SMARCA2 HLCS CARD14 KRT17 CIITA HLA-DPB1 KIF11 MEFV AP1B1 IL10 COL5A1 PTPRC DNASE1 NSUN2 IL12A-AS1 PAPSS2 ARVCF KRT5 RAG2 SEC24C SMARCAD1 FCGR2A IL2RG DNAJC21 CD28 AIP PNPLA1 SPTB FLI1 CD3E PLA2G7 ELANE SULT2B1 CHST14 JMJD1C TCF3 SLC29A3 COMT AGA SDR9C7 CLEC7A STAT3 ADAM17 CD247 SPTA1 TNFRSF1A KRT1 GJB6 BCL11B BLNK MEIS2 FAM111B NLRP3 MYSM1 GJB2 HLA-DRB1 IRF2BP2 LAMB3 CD79B KDF1 MPLKIP ABCA12 CASR POMP NCF1 NCSTN CYP4F22 SRP54 RNU4ATAC IL1RN MNX1 EFL1 FECH SHOC2 MIF C1R GP1BB POLR3A WIPF1 CARMIL2 CTSC TTC7A JAK3 DOCK8 FLI1 KRT14 NLRP12 SPP1 CTLA4 GJB3 IL7R GJB2 USP8 SUOX FOXC2 FOXP3 GATA3 CYBB LHCGR COL1A1 DCLRE1C PSMB4 PTPN22 KIT SP110 BTNL2 TMC8 BTK CCBE1 CTSB GJA1 PRKACA PGM3 EDAR LPIN2 RREB1 PEPD RNU4ATAC GPR101 GTF2E2 H6PD PIGA C1QA KRT10 KLRC4 CFI BTK HLA-B PDGFRA APOA1 ZAP70 LIG4 ADAMTS3 EPB42 TMC6 ERCC2 ELANE BTNL2 KIT SDHA STAT3 IL17F ADA DSG1 PRTN3 NFE2L2 KRT1 COX4I2 NOD2 RMRP FGA ANK1 ALOXE3 COL7A1 COL5A2 NFKB2 DDX41 HPGD CCR1 ERCC2 AK2 LACC1 HSD3B2 LIG4 IL17RA TARS1 TCIRG1 SH3PXD2B SMARCC2 WIPF1 RFXANK IL7 LMBRD1 MSMO1 TNFRSF1B LBR FGFR2 IL17RC TBX1 PTPN22 RBCK1 IL17F STAT4 ABCA12 GJC2 C5 ABCA12 GJB4 AUTS2 HLA-DRB1 AP1S3 CCBE1 GFI1 EPG5 RNF113A TEK POR ERCC3 NAXD RFXANK GATA1 CARD11 HLA-DQB1 GJC2 FLT4 SBDS LYST TTC7A STAT1 CYBC1 PCCB HLA-DPA1 RIPK1 HPGD RAG2 BTD CLEC7A PAH NR3C1 BTD KRT16 DNAJC21 IL10RA CIITA ADA EXTL3 ZNF341 SIK3 TNFRSF1A PSENEN IL7R MYD88 SRD5A3 HLCS LBR IGHM TRAF3IP2 LIG4 NSMCE3 GTF2H5 KRT10 ESR1 PGM3 CYP4F22 IL12A PSMB8 TNFRSF1B IL23R RFX5 NIPAL4 DNASE1L3 IL10RB IL6 EGFR KRT9 CTLA4 SLC39A4 LIPN ECM1 POLE TRAF3IP2 HLA-B MBTPS2 RAC1 SHANK3 XYLT1 ZAP70 UFD1 KANSL1 FAT4 NIPAL4 CARD9 TGM1 ACADVL SLC30A2 CYBB PSEN1 FECH GNA11 ALOXE3 CYBA TREX1 RAG1 PSMB9 NCF1 AIRE RBM8A SDHC LPIN2 RAG1 TFRC NLRC4 FOXP3 KRT10 ERAP1 TAF1 ITGA6 SDHB LYST HDAC4 RTTN CD3D VEGFC CTLA4 DCLRE1C LRRC8A NSUN2 CTLA4 IL7R NOD2 CARD14 IL2RG CASP8 FCGR2B RAG1 MPDU1 IGLL1 PSTPIP1 NCF2 KRT1 PNPLA1 ERCC3 WAS RAC1 CTLA4 CD79A SLC4A1 CDK10 STAT1 RBP4 FAS AIRE KDF1 TRAF6 NCF2 ITGB4 WAS IL2RA PAH HLA-DRB1 TLR4 MBL2 STAT4 NEK9 LAMA3 IL4R MVK MTHFD1 ADA2 GLUL LAMC2 NCF4 XIAP PIK3R1 EDA CHD7 ALOX12B IL36RN CDH23 UBE2A STING1 HSPA9 UBAC2 PIK3CA SRP54 ESR1 C4A CD28 RAG2 IRAK1 RFXAP ABCC6 NIPAL4 NCF4 IL2RG UROS SMARCA2 MEFV TGM1 FERMT1 PCCA MVK EBP TBX1 TGM1 GJB2 HLA-C IKBKG NFKB2 DCLRE1C
Leukemia
Genes 190
ATM KRAS KIT RPS15A NF1 MPL RPL35A RPL11 RPL18 DDX41 SBDS LPP ETV6 BUB1B F13A1 DNMT3A JAK2 NUP214 FANCD2 MSH6 FANCA PIGL NRAS TCIRG1 BUB1 TET2 FLT3 TAL1 ATRX TREX1 PDGFRA SRP54 RPS29 PTPN11 CALR FANCE WIPF1 SF3B1 GATA2 GLI1 STS SH3GL1 XRCC4 MPL SH2B3 EFL1 PIGA TREM2 CBL MPL RUNX1 MPL PIGL THPO FANCG NSD1 BRD4 NSUN2 SH2B3 RARA GATA2 NPM1 CBL CHIC2 ERBB3 GFI1 TERT KIT BCR ARHGAP26 DYNC2LI1 EVC SCN10A GATA1 ELANE RNASEH2B RPS14 SH2B3 JAK2 RPL15 SBDS NRAS RPL26 RPL27 ADA2 RPS7 TYROBP F13B MSH2 BCR WAS TERC TP53 TRIP13 MYD88 NUTM1 RPS24 GNB1 TP53 DNMT3A TERT NUMA1 NUP214 RPL5 SAMD9L TET2 CFTR POT1 FANCC RPS10 EP300 EVC2 BUB1B CEBPA BRCA2 DNAJC21 CALR SCN9A LIG4 ADAR BLM TET2 JAK2 SMPD1 RNASEH2C SCN11A GATA2 BUB3 PRSS1 KIF11 BCR RPL35 TAL2 SRP54 IFIH1 ABL1 PDGFRB KRAS RNASEH2A TET2 MLLT10 SRP54 DNAJC21 DKC1 RUNX1 APC LIG4 CBFB BLM THPO CALR NBN JAK2 MLH1 RPS19 ELANE SAMD9L RPL31 PMS2 ASXL1 TSR2 MLF1 PIK3CA DNAJC21 RUNX1 GFI1 SRSF2 SETBP1 HAX1 RPS26 RPS17 FLT3 RPS27 PIK3R1 KRAS CEP57 PICALM CREBBP GATA2 CTRC MYD88 TET2 RPS28 ABL1 RB1 SPINK1 GATA1 NBN JAK2 SAMHD1
Psychosis
Genes 116
TWNK SNRPN GRN NAGS SNORD116-1 SLC7A7 PRKAR1A UPF3B TREX1 TREM2 TRNH WFS1 IPW CLN8 ALDH5A1 SPART PCDH19 ND4 AIP NPAP1 LMBRD1 TRNL1 MKRN3 SLC25A13 PSEN1 ABCD1 MECP2 C1R TRNQ NDP RPS6KA3 PTPN22 ZDHHC9 STAT4 ATXN7 TRNS2 PRDM8 VCP HMBS GSS DCAF17 PARK7 FCGR2B PDE11A ITM2B TBC1D7 ZFYVE26 SPP1 TRNS1 PANK2 SQSTM1 CTLA4 PDGFB PWRN1 USP8 MED12 SLC20A2 HFE NPC2 NHLRC1 SLC12A6 C9ORF72 NDN COX1 CHMP2B MAGEL2 CBS MKRN3-AS1 EPM2A TRNF VPS13A PAH ALDH18A1 PAK3 NPC1 ND1 USP8 TMEM106B PWAR1 MAPT PDGFB KCNT1 TRNW COX3 NDP ALAD GCLC CDH23 PCDH19 C1QA C9ORF72 PRNP CLN3 MYORG COX2 DNASE1 PPOX SLC6A19 SOBP DCAF17 SNORD115-1 WFS1 IRAK1 FCGR2A ND6 TTC19 SH2B1 MED12 GNAS DNMT1 ND5 CACNA1A ACADS HERC2 PDGFRB ATP13A2
Back pain
Genes 48
EMD HGD LMNA DLL3 PDGFB ATP7B CLCN7 VANGL1 TP53 TMEM43 SEC63 PLEKHM1 SMAD4 CAPN3 SYNE1 MESP2 BRCA2 SMARCB1 ALDH18A1 SUFU PRKCSH FHL1 PALB2 LMNA LRP5 LMX1B NAB2 TCIRG1 PALLD FHL1 NF2 HELLPAR SPAST SYNE2 VCP CFI TBX6 HLA-B BRCA1 STAT6 CFH PRKCSH HTRA1 FLI1 CD46 CDKN2A KRAS VCP
Eczema
Genes 150
COL5A2 TGM5 GTF2H5 SLC30A2 DDX41 CYBB HPGD FECH ERCC2 MSN GNA11 CYBA MYSM1 NCF1 HLA-DRB1 RBM8A KDF1 MPLKIP TARS1 CASR MCCC2 NCF1 SMARCC2 FOXP3 STAT3 GINS1 RNU4ATAC TAF1 WIPF1 IL7 HDAC4 RTTN TNFRSF1B TP63 LBR FLG DHCR7 EFL1 FECH SHOC2 KRT1 TBX1 GP1BB RBCK1 WIPF1 NSUN2 CTLA4 CARMIL2 TRPM1 CARD14 WAS C5 CIB1 CASP8 DOCK8 FLI1 AUTS2 NCF2 RNF113A HPGD ERCC3 WAS RAC1 CARD11 SUOX HLA-DQB1 STAT1 SBDS FOXP3 ZNF750 MS4A2 TRAF6 TBX1 NCF2 CYBB WAS STAT1 COL1A1 CYBC1 PCCB IL2RA PAH IFIH1 HPGD SPINK5 HIRA SLCO2A1 NEK9 BRAF TMC8 BTD IL4R CD3G PAH EDARADD MTHFD1 CYBA CSTA PGM3 NCF4 BTD KRT16 EDA EDAR DNAJC21 DOCK8 ZNF341 SMARCA2 RREB1 RNU4ATAC SIK3 GTF2E2 IL7R PIGA SRD5A3 HSPA9 HLCS COL5A1 PIK3CA PTPRC SRP54 ZAP70 LIG4 NSUN2 NSMCE3 CD28 PGM3 ARVCF TMC6 SEC24C NCF4 DNAJC21 KRT9 CTLA4 SMARCA2 STAT3 POLE FLI1 PCCA PLA2G7 JMJD1C TRAF3IP2 MBTPS2 RAC1 TBX1 COMT UFD1 NOD2 KANSL1 STAT3
Low back pain
Genes 6
HTRA1 SPAST ALDH18A1 NAB2 TBX6 STAT6
Atopic dermatitis
Genes 9
DOCK8 IFIH1 HSPA9 DOCK8 ZNF341 PGM3 CARD11 NEK9 BRAF
Hemiplegia
Genes 36
HLA-DPA1 PAH ARX PTPN22 ADA2 SCN1A NOTCH3 SLC1A3 STAT4 ATP1A2 SLC1A3 IRAK1 KRAS ATP1A3 GNAQ COL4A1 DOCK8 CTC1 ADA2 CACNA1A SNORD118 COL4A2 SPP1 PRF1 TBC1D24 CTLA4 FGFR1 POLA1 SUOX PRTN3 HLA-DPB1 C1QA ATP1A2 CACNA1A GCDH C1R
Lymphoma
Genes 133
ATM KRAS CD19 IGH DDX41 BCL10 BIRC3 FOXP1 MS4A1 TP63 RAG1 LIG4 NFKB2 MSH6 TERC RECQL4 NTHL1 WIPF1 CTC1 LYST NOP10 RASGRP1 TNFRSF1B XRCC4 PRKCD NHP2 MAGT1 TNFRSF13B IGH RMRP RUNX1 CTLA4 DCLRE1C FAS ICOS RNF43 NSUN2 XIAP IL7R CASP10 BCL6 CDKN2A ATM IL2RG RTEL1 PARN NBN KIT TNFRSF13C TCF4 ICOS TNFSF12 CHEK2 USB1 CD19 CR2 NRAS MSH2 WAS BCL10 CASP10 MYD88 COL14A1 PRKCD TNFRSF13B MYC MDM2 SH2D1A CCND1 BCL10 CFTR CD27 PGM3 TCF4 CHD7 IGH LIG4 BLM BCL2 TET2 HLA-DRB1 PRSS1 NPM1 KIF11 ITK WRAP53 RAD54B TINF2 FAS DKC1 APC CD81 LIG4 BLM CD28 DKC1 AAGAB RAG2 TNFRSF1B MLH1 TNFRSF13C DNASE1L3 NFKB1 PMS2 ASXL1 IL2RG PRF1 PTEN MALT1 RAD54L CTLA4 CD28 PNP SRSF2 TNFSF12 STAT3 POLE ADA CR2 ADA FASLG PIK3R1 TP53 CTRC ZAP70 MYD88 RB1 RMRP SPINK1 TERT KLHDC8B NBN RHOH
Psoriasiform dermatitis
Genes 22
NFKB2 LIG4 DSG1 CARD14 FOXP3 CTLA4 SLC29A3 HLA-B IL36RN HLA-DQB1 MSMO1 TTC7A GATA3 HLA-DRB1 TTC7A FLI1 CACNA1G HLA-C AP1S3 IRF2BP2 TP63 NFKB2
Hemiparesis
Genes 85
TRNL1 CFHR1 TLR4 SCN1A SP110 STAT4 CCR1 HLA-DQB1 ARHGAP31 TRNW TRNC TREX1 SMARCB1 ND1 OPA1 GNAQ COL4A1 EOGT TRNS2 PNPLA8 TRNS1 GUCY1A1 CYP26C1 NF2 TBC1D24 SLC2A1 FGFR1 PRNP ALAD TPP2 ERAP1 TRNK CYTB TSC1 RBPJ ATP1A2 TUBB2B NOTCH1 COX2 COL3A1 KLRC4 IL10 TBK1 DNM1L UBAC2 HLA-B DOCK6 TRNQ ADA2 RHOBTB2 PDGFB TSC2 C4A SLC1A3 GBE1 IL12A-AS1 IL12A IL23R ND6 KRAS CFH ENG TGFBR3 WDR62 SUFU ND5 TTR ANGPTL6 MEFV MTOR SLC2A1 DLL4 COX1 TBC1D24 TRNV TREX1 RASA1 CFHR3 COX3 TRNF ATP1A3 TUBB2B FAS CACNA1A TLR3